Add middle adapter example

README.md

@@ -108,6 +108,11 @@ The default `--middle_threshold` (85%) is higher than the default `--end_thresho
 
 Extra bases are also removed next to the hit, and how many depends on the side of the adapter. If we find an adapter that's expected at the start of a read, it's likely that what follows is good sequence but what precedes it may not be. Therefore, a few bases are trimmed after the adapter (default 10, change with `--extra_middle_trim_good_side`) and more bases are trimmed before the adapter (default 100, change with `--extra_middle_trim_bad_side`). If the found adapter is one we'd expect at the end of the read, then the "good side" is before the adapter and the "bad side" is after the adapter.
 
+Here is a real example of the "good" and "bad" sides of an adapter. The adapter is in the middle of this snippet (SQK-NSK007_Y_Top at about 90% identity). The bases to the left are the "bad" side, and their repetitive nature is clear. The bases to the right are the "good" side and represent real biological sequence.
+```
+TGTTGTTGTTGTTATTGTTGTTATTGTTGTTGTATTGTTGTTATTGTTGTTGTTGTACATTGTTATTGTTGTATTGTTGTTATTGTTGTTGTATTATCGGTGTACTTCGTTCAGTTACGTATTACTATCGCTATTGTTTGCAGTGAGAGGTGGCGGTGAGCGTTTTCAAATGGCCCTGTACAATCATGGGATAACAACATAAGGAACGGACCATGAAGTCACTTCT
+```
+
 
 
 # Verbose output