Deployment

NAMESPACE

@@ -0,0 +1,19 @@
+# Generated by roxygen2: do not edit by hand
+
+S3method("$",module)
+S3method(print,module)
+export("?")
+export(help)
+export(import)
+export(import_)
+export(import_package)
+export(import_package_)
+export(module_file)
+export(module_help)
+export(module_name)
+export(register_S3_method)
+export(reload)
+export(set_script_path)
+export(unload)
+importFrom(stats,setNames)
+importFrom(utils,lsf.str)

inst/doc/basic-usage.R

@@ -0,0 +1,66 @@
+## ----include=FALSE-------------------------------------------------------
+devtools::load_all()
+import('source-file')
+
+## ------------------------------------------------------------------------
+seq = import('utils/seq')
+ls()
+
+## ------------------------------------------------------------------------
+ls(seq)
+
+## ----eval=FALSE----------------------------------------------------------
+#  ?seq$seq
+
+## ------------------------------------------------------------------------
+s = seq$seq(c(foo = 'GATTACAGATCAGCTCAGCACCTAGCACTATCAGCAAC',
+              bar = 'CATAGCAACTGACATCACAGCG'))
+s
+
+## ------------------------------------------------------------------------
+seq$print.seq
+
+## ------------------------------------------------------------------------
+# We can unload loaded modules that we assigned to an identifier:
+unload(seq)
+
+options(import.path = 'utils')
+import('seq', attach = TRUE)
+
+## ------------------------------------------------------------------------
+search()
+
+## ------------------------------------------------------------------------
+detach('module:seq') # Name is optional
+local({
+    import('seq', attach = TRUE)
+    table('GATTACA')
+})
+
+## ------------------------------------------------------------------------
+search()
+table('GATTACA')
+
+## ----file='utils/__init__.r'---------------------------------------------
+
+## ------------------------------------------------------------------------
+options(import.path = NULL) # Reset search path
+utils = import('utils')
+ls(utils)
+ls(utils$seq)
+utils$seq$revcomp('CAT')
+
+## ----eval=FALSE----------------------------------------------------------
+#  export_submodule('./seq')
+
+## ----file='info.r'-------------------------------------------------------
+
+## ------------------------------------------------------------------------
+info = import('info')
+
+## ------------------------------------------------------------------------
+import('info')
+
+## ------------------------------------------------------------------------
+reload(info)
+

inst/doc/basic-usage.md

@@ -0,0 +1,289 @@
+Basic module usage
+==================
+
+The `seq` module
+----------------
+
+For the purpose of this tutorial, we are going to use the toy module
+`utils/seq`, which is implemented in the file
+[`utils/seq.r`](utils/seq.r). The module implements some very basic
+mechanisms to deal with DNA sequences (character strings consisting
+entirely of the letters `A`, `C`, `G` and `T`).
+
+First, we load the module.
+
+``` r
+seq = import('utils/seq')
+ls()
+```
+
+    ## [1] "seq"
+
+`utils` serves as a supermodule here, which groups several submodules
+(but for now, `seq` is the only one).
+
+To see which functions a module exports, use `ls`:
+
+``` r
+ls(seq)
+```
+
+    ## [1] "print.seq"         "revcomp"           "seq"              
+    ## [4] "table"             "valid_seq"         "valid_seq.default"
+    ## [7] "valid_seq.seq"
+
+And we can display interactive help for individual functions:
+
+``` r
+?seq$seq
+```
+
+This function creates a biological sequence. We can use it:
+
+``` r
+s = seq$seq(c(foo = 'GATTACAGATCAGCTCAGCACCTAGCACTATCAGCAAC',
+              bar = 'CATAGCAACTGACATCACAGCG'))
+s
+```
+
+    ## >foo
+    ## GATTACAGATCAGCTCAGCACCTAGCACTATCAGCAAC
+    ## >bar
+    ## CATAGCAACTGACATCACAGCG
+
+Notice how we get a pretty-printed,
+[FASTA](http://en.wikipedia.org/wiki/FASTA_format)-like output because
+the `print` method is redefined for the `seq` class in `utils/seq`:
+
+``` r
+seq$print.seq
+```
+
+    ## function (seq, columns = 60) 
+    ## {
+    ##     lines = strsplit(seq, sprintf("(?<=.{%s})", columns), perl = TRUE)
+    ##     print_single = function(seq, name) {
+    ##         if (!is.null(name)) 
+    ##             cat(sprintf(">%s\n", name))
+    ##         cat(seq, sep = "\n")
+    ##     }
+    ##     names = if (is.null(names(seq))) 
+    ##         list(NULL)
+    ##     else names(seq)
+    ##     Map(print_single, lines, names)
+    ##     invisible(seq)
+    ## }
+    ## <environment: 0x7fe2603a8580>
+
+Attaching modules
+-----------------
+
+That’s it for basic usage. In order to understand more about the module
+mechanism, let’s look at an alternative usage:
+
+``` r
+# We can unload loaded modules that we assigned to an identifier:
+unload(seq)
+
+options(import.path = 'utils')
+import('seq', attach = TRUE)
+```
+
+After unloading the already loaded module, the `options` function call
+sets the module search path: this is where `import` searches for
+modules. If more than one path is given, `import` searches them all
+until a module of matching name is found.
+
+The `import` statement can now simply specify `seq` instead of
+`utils/seq` as the module name. We also specify `attach=TRUE`. This has
+an effect similar to package loading (or `attach`ing an environment):
+all the module’s names are now available for direct use without
+necessitating the `seq$` qualifier.
+
+However, unlike the `attach` function, module attachment happens *in
+local scope* only. Since the above code was executed in global scope,
+there’s no distinction between local and global scope:
+
+``` r
+search()
+```
+
+    ##  [1] ".GlobalEnv"        "module:seq"        "devtools_shims"   
+    ##  [4] "package:modules"   "package:stats"     "package:graphics" 
+    ##  [7] "package:grDevices" "package:utils"     "package:datasets" 
+    ## [10] "rprofile"          "Autoloads"         "package:base"
+
+Notice the second position, which reads “module:seq”. But now let’s undo
+that, and attach (and use) the module locally instead.
+
+``` r
+detach('module:seq') # Name is optional
+local({
+    import('seq', attach = TRUE)
+    table('GATTACA')
+})
+```
+
+    ## [[1]]
+    ## 
+    ## A C G T 
+    ## 3 1 1 2
+
+Note that this uses `seq`’s `table` function, rather than `base::table`
+(which would have a different output). Furthermore, note that *outside*
+the local scope, the module is not attached:
+
+``` r
+search()
+```
+
+    ##  [1] ".GlobalEnv"        "devtools_shims"    "package:modules"  
+    ##  [4] "package:stats"     "package:graphics"  "package:grDevices"
+    ##  [7] "package:utils"     "package:datasets"  "rprofile"         
+    ## [10] "Autoloads"         "package:base"
+
+``` r
+table('GATTACA')
+```
+
+    ## 
+    ## GATTACA 
+    ##       1
+
+This is very powerful, as it isolates separate scopes more effectively
+than the `attach` function. What is more, modules which are imported and
+attached inside another module *remain* inside that module and are not
+visible outside the module by default.
+
+Nevertheless, the normal, recommended usage of a module is with
+`attach=FALSE` (the default), as this makes it clearer which names we
+are referring to.
+
+Nested modules
+--------------
+
+Modules can also be nested in hierarchies. In fact, here is the
+implementation of `utils` (in [`utils/__init__.r`](utils/__init__.r):
+since `utils` is a directory rather than a file, the module
+implementation resides in the nested file `__init__.r`):
+
+``` r
+seq = import('./seq')
+```
+
+The submodule is specified as `'./seq'` rather than `'seq'`: the
+explicitly provided relative path prevents lookup in the import search
+path (that we set via `options(import.path=…)` earlier); instead, only
+the current directory is considered.
+
+We can now use the `utils` module:
+
+``` r
+options(import.path = NULL) # Reset search path
+utils = import('utils')
+ls(utils)
+```
+
+    ## [1] "seq"
+
+``` r
+ls(utils$seq)
+```
+
+    ## [1] "print.seq"         "revcomp"           "seq"              
+    ## [4] "table"             "valid_seq"         "valid_seq.default"
+    ## [7] "valid_seq.seq"
+
+``` r
+utils$seq$revcomp('CAT')
+```
+
+    ## ATG
+
+We could also have implemented `utils` as follows:
+
+``` r
+export_submodule('./seq')
+```
+
+This would have made all of `seq`’s definitions immediately available in
+`utils`. This is sometimes useful, but should be employed with care.
+
+Implementing modules
+--------------------
+
+`utils/seq.r` is, by and large, a normal R source file. In fact, there
+are only two things worth mentioning:
+
+1.  Documentation. Each function in the module file is documented using
+    the
+    [roxygen2](http://cran.r-project.org/web/packages/roxygen2/index.html)
+    syntax. It works the same as for packages. The *modules* package
+    parses the documentation and makes it available via `module_help`
+    and `?`.
+
+2.  The module exports [S3 functions](http://adv-r.had.co.nz/S3.html).
+    The *modules* package takes care to register such functions
+    automatically but this only works for *user generics* that are
+    defined inside the same module. When overriding “known generics”
+    (such as `print`), we need to register these manually via
+    `register_S3_method` (this is necessary since these functions are
+    inherently ambiguous and there is no automatic way of finding them).
+
+Module files can contain arbitrary code. It is executed when loaded for
+the first time: subsequent `import`s in the same session, regardless of
+whether they occur in a different scope, will refer to the loaded,
+cached module, and will *not* reload a module.
+
+We can illustrate this by loading a module which has side-effects,
+`'info'`.
+
+``` r
+message('Loading module "', module_name(), '"')
+message('Module path: "', basename(module_file()), '"')
+```
+
+Let’s load it:
+
+``` r
+info = import('info')
+```
+
+    ## Loading module "info"
+
+    ## Module path: "vignettes"
+
+We have imported the module, and get the diagnostic messages. Let’s
+re-import the module:
+
+``` r
+import('info')
+```
+
+… no messages are displayed. However, we can explicitly *reload* a
+module. This clears the cache, and loads the module again:
+
+``` r
+reload(info)
+```
+
+    ## Loading module "info"
+
+    ## Module path: "vignettes"
+
+And this displays the messages again. The `reload` function is a
+shortcut for `unload` followed by `import` (using the exact same
+arguments as used on the original `import` call).
+
+The `info` module also show-cases two important helper functions:
+
+1.  `module_name` contains the name of the module with which it was
+    loaded. This is especially handy because outside of a module
+    `module_name` is `NULL`. We can harness this in a similar way to
+    Python’s `__name__` mechanism.
+
+2.  `module_file` works equivalently to `system.file`: it returns the
+    full path to any file within a module. This is helpful when
+    distributing data files with modules, which are loaded from within
+    the module. When invoked without arguments, `module_file` returns
+    the full path to the directory containing the module source file.