BoltzmannFileFormat

Specification of the Boltzmann file format (*.boltz)

Due to requests by users of RNAStructViz, we have implemented a new (non-standardized) file format which can be used to load sequences within the application (see issue #41). As with many output formats from utility suites such as the (now defunct) GTBoltzmann, this file format allows users to specify sequence bases and pairing data with helix triples in (i,j,k) notation. The key components of this file format are provided for reference to users as follows:

• Optional file comment line (analogous to the standard CT file formats)
• Sequence base data, all on a single line
• Secondary structures on the sequence, one per line, beginning with the pairing data for the sequence in the standard Dot-Bracket format for specifying pairs; then free energy and helices listed as triples are appended at the end of the line
• Only up to 20 samples may be specified per file (see known limitations)

Example of the file format

The following example serves as documentation for the new format:

> Sequence file comment goes here
CAAAAGCACCAGGGGUGCUUGAACCAGGAUAGCCUGCGAAAAGGCGGGCUAUCCGGGACCAGGCUGAGAAAGUCCCUUUGAACCUGAACAGGGUAAUGCCUGCGCAGGGAGUGUGCAGUUUUUUUUUU
.....((((((((((((((((..((.(((((((((((......))))))))))).))..)))))..)......)))).))..((((..((((......))))..))))....))))............	-49.4	6 116 4, 10 80 2, 12 77 4, 16 67 1, 17 64 5, 24 57 2, 27 54 11, 83 108 4, 89 102 4, 
.....(((((((((..(((((..((.(((((((((((......))))))))))).))..))))).........)))).....((((..((((......))))..))))..).))))............	-52.9	6 116 4, 10 111 1, 11 77 4, 17 64 5, 24 57 2, 27 54 11, 83 108 4, 89 102 4, 
.....((((((((((.(((((..((.(((((((((((......))))))))))).))..))))).((.....))))))))..((((..((((......))))..))))....))))............	-53.9	6 116 4, 10 80 6, 17 64 5, 24 57 2, 27 54 11, 66 74 2, 83 108 4, 89 102 4, 
.....(((((.(((..(((((..((.(((((((((((......))))))))))).))..)))))(......).)))......((((..((((......))))..))))..).))))............	-50.8	6 116 4, 10 111 1, 12 76 3, 17 64 5, 24 57 2, 27 54 11, 65 72 1, 83 108 4, 89 102 4, 
.....((((((((((.(((((..((.(((((((((((......))))))))))).))..))))).((.....))))))))..((((..((((......))))..))))....))))............	-53.9	6 116 4, 10 80 6, 17 64 5, 24 57 2, 27 54 11, 66 74 2, 83 108 4, 89 102 4, 
.....((((((((((....((..((.(((((((((((......))))))))))).))..))((((.....))))))))))..((((..((((......))))..))))....))))............	-52.2	6 116 4, 10 80 6, 20 61 2, 24 57 2, 27 54 11, 62 74 4, 83 108 4, 89 102 4, 
.....((((((((((((((((..((.(((((((((((......)))))))))))))...))))).......)))))).....((((..((((......))))..))))..).))))............	-51.9	6 116 4, 10 111 1, 11 77 6, 17 64 5, 24 56 2, 27 54 11, 83 108 4, 89 102 4, 
...((((((((((((.(((((..((.(((((((((((......))))))))))).))..)))))........))))).....((((..((((......))))..))))..).))))..))........	-48.8	4 120 2, 6 116 4, 10 111 1, 11 77 5, 17 64 5, 24 57 2, 27 54 11, 83 108 4, 89 102 4,