Skip to content
New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

Sign up for GitHub

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

removed spaces in INRB primer sequence #10

Open
wants to merge 1 commit into
base: master
Choose a base branch
from
Open

removed spaces in INRB primer sequence #10

Changes from all commits
Commits
Show all changes
1 commit
Select commit
File filter

Filter by extension

Filter by extension
Conversations
Failed to load comments.
Loading
Jump to
Jump to file
Failed to load files.
Loading
Diff view
Diff view
6 changes: 3 additions & 3 deletions data/primer_schemes/MPXV/artic-inrb-mpox/v1.0.0-cladeia/primer.bed
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -1,7 +1,7 @@
#artic-bed-version v3.0
KJ642613.1_masked 133 158 2o0fvmwf_1_LEFT_1 1 + CGTGAGTAGTGTCCCCTACATGGAT
KJ642613.1_masked 136 158 2o0fvmwf_1_LEFT_2 1 + GAGCAGTGTCCCCTACATGGAT
KJ642613.1_masked 135 158 2o0fvmwf_1_LEFT_3 1 + TGAGCAGTGTTCCCTACATGGAT
KJ642613.1_masked 133 158 2o0fvmwf_1_LEFT_1 1 + CGTGAGTAGTGTCCCCTACATGGAT
KJ642613.1_masked 136 158 2o0fvmwf_1_LEFT_2 1 + GAGCAGTGTCCCCTACATGGAT
KJ642613.1_masked 135 158 2o0fvmwf_1_LEFT_3 1 + TGAGCAGTGTTCCCTACATGGAT
KJ642613.1_masked 2749 2780 359ba5b8_1_RIGHT_1 1 - ATAATCAATCTAGACTATCGTATTTGCCTCC
KJ642613.1_masked 2749 2777 359ba5b8_1_RIGHT_2 1 - GTCAATCTAGACTATCGTATTTGCCTCC
KJ642613.1_masked 2480 2502 359ba5b8_2_LEFT_1 2 + CCATTGGATGGTGCATGTGGTG
Expand Down