VirtualEating

Andrew Lane, University of California, Berkeley

Changelog:

20150930 (v. 2.0): Major overhaul. The iPython notebook examples/implementation have been deprecated (moved to the archive folder) and the core logic abstracted into the eating package. 20150530 (v. 1.0): Initial release.

Description

The eating package is a set of functions designed to help in planning, implementing and analyzing CRISPR-EATING enzymatically generated sgRNA libraries for genome labeling or screening as decribed in Lane et al., 2015

Given that CRISPR-EATING protocol produces sgRNAs from any source of DNA, it's essential to be able to predict, tune and analyze the sgRNA output of the protocol.

*Please contact [email protected] if you would like access to a multithreaded Amazon Web Services-deployable version. This version has modfications that separate database and parallelized scoring/BLAST threads, making it much faster and more scaleable when scoring large numbers of guides but somewhat more complex to deploy. SQLite databases with scores for all possible guides in hg19/GRCh37 are also available.

For each function, parameters are described in the function's docstring.

The eating package addresses this as follows:

• Prediction is covered by eating.base:

  • Given an input DNA sequence, base provides functions to predict the output of CRISPR-EATING when the molecular biology protocol is applied to that sequence.
  • base.digest_target simulates PAM selection, cutting and MmeI-20mer trimming of input DNA to produce a list of sgRNAs
  • base.score_guides uses the BioPython BLAST interface on a local BLAST installation and database to generate target-genome-wide off-target analysis of sgRNAs and processes the resulting hit data into a per-guide score by implementing the sgRNA off-target scoring algorithm described in Hsu et al., 2013.
    • The implementation memoizes and stores the calculated scores in an sqlite database that can be re-used in other workflows
  • base.count_non_overlapping_guides is a helper function to aggregate a linear cluster of guides and count the true non-overlapping count of guides within that region. This is useful for applications such as CRISPR-imaging, where guide tiling density is the desired characteristic.

• Tuning is covered by eating.designpcr

  • designpcr.find_amplicons searches for regions of an input genome that, when PCR amplified, will be digested into tens or hundreds of highly-specific sgRNAs. The resulting Amplicon class stores information about the location of the guides within the genome, the identities of the individual guides, their scores and, importantly, how close these clusters are to low-scoring guides that must be avoided in downstream PCR.
  • designpcr.primer_search proposes and specificity-screens primers to amplify chosen amplicons
    • Primers are proposed using the fast primer3-py interface
    • designpcr.screen_primer_in_silico_pcr implements an in-silico PCR strategy to determine if primers proposed by primer3-py are likely to be successful on the target genome. Each primer is BLAST-ed against the template genome and the distance and orientation between matching sites in the genome is analyzed to ensure that off-target binding of primers cannot produce an amplicon. In practice, around 85% of the predicted-good primers output by this tool produce a single band in PCR using the protocol described the CRISPR-EATING paper.
  • designpcr.collect_good_primers outputs primers and amplicon attributes, including size of amplicon and number of guides generated from an individual amplicon into CSV file for ordering of oligonucleotides from IDT.
  • Sample Output:

  Gene	Sequence_id	forward_seq	forward_start	forward_length	forward_tm	forward_gc	reverse_seq	reverse_start	reverse_length	reverse_tm	reverse_gc	input_seq_length	PCR_product_length	Guides_Contained	Non-overlapping Guide Count
  GNB2L1	6282	GGGATAGGGACGGGGAGAAC	432	20	61.12018408	65	ACCCTCCGGAAGCACAGTT	1600	19	61.1473871	57.89473684	1596	1168	41	36
  EF1A	3947	ACAGAAGCAACCAAAAATCAAACTT	157	25	58.82737049	32	TCCCTTCCAGGCGGCCTC	1948	18	63.80873271	72.22222222	1942	1791	43	36
  EEF1G	13188	AATGCCACTCTCCAGGATGA	202	20	58.41176058	50	AGGAGGTGGGAGGGACAG	1984	18	59.54788591	66.66666667	1989	1782	59	52
  

• Analysis is covered by a limited number of functions (eating.visualize). These are designed to operate on FASTQ files resulting from HiSeq 2000 sequencing of CRISPR-EATING libraries.

  • visualize.plot_complexity attempts to describe the diversity of the resulting sgRNA library by plotting unique sequences against sequence count. This is intended to be a quick screen for gross PCR "jackpotting" (aka the overamplification of one or a few sequences in PCR).
  • visualize.string2feat annotates Bio.Seq objects with the locations of sgRNAs observed in sequencing. This is useful for troubleshooting, e.g., failures of the Mung-Bean nuclease step where observed guides are preferentially found at the termini of amplicons.

Installation:

Copy the eating folder from this git repo into to your python site-packages directory or your project working directory.

Usage

import eating

Consult individual function docstrings for instructions or contact [email protected] for code orientation.