Repeated dna seq (#204)

* add repeated dna seq

* impl repeated dna seq

leetcode-cc/RepeatedDNASeq.hpp

@@ -0,0 +1,52 @@
+#include <unordered_set>
+
+#include "TestHelper.h"
+#include "problem.h"
+#include "solution.h"
+
+using namespace std;
+
+IMPLEMENT_PROBLEM_CLASS(
+    PRepeatedDNASeq, 187, DIFFI_MEDIUM, TOPIC_ALGORITHMS,
+    "Repeated DNA Sequences",
+    "Given a string s that represents a DNA sequence, return all the "
+    "10-letter-long sequences (substrings) that occur more than once in a DNA "
+    "molecule. You may return the answer in any order.",
+    {"Hash Table & Sliding Window"});
+
+class SRepeatedDNASeq : public ISolution {
+ public:
+  size_t problemId() const override { return 187; }
+  string name() const override {
+    return ("Solution for " + string("Repeated DNA Sequences"));
+  }
+  string location() const override { return __FILE_NAME__; }
+  int test() const override {
+    return testHelper<string, vector<string>>(
+        {"AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT", "AAAAAAAAAAAAA"},
+        {{"CCCCCAAAAA", "AAAAACCCCC"}, {"AAAAAAAAAA"}},
+        [this](auto input) { return this->findRepeatedDnaSequences(input); });
+  };
+  int benchmark() const override { return 0; }
+
+ private:
+  vector<string> findRepeatedDnaSequences(string s) const {
+    const int N = 10;
+    int n = s.size();
+    if (n < N) return {};
+
+    unordered_set<string> res = {};
+    unordered_set<string> memo = {};
+
+    for (int i = 0; i <= n - N; i++) {
+      auto subs = s.substr(i, N);
+      if (memo.contains(subs)) {
+        res.insert(subs);
+      } else {
+        memo.insert(subs);
+      }
+    }
+
+    return vector(res.begin(), res.end());
+  }
+};

runtime-cc/src/registration.cc

@@ -82,6 +82,7 @@
 #include "../leetcode-cc/RemoveElement.hpp"
 #include "../leetcode-cc/RemoveNthNode.hpp"
 #include "../leetcode-cc/ReorderList.hpp"
+#include "../leetcode-cc/RepeatedDNASeq.hpp"
 #include "../leetcode-cc/RestoreIpAddresses.hpp"
 #include "../leetcode-cc/ReverseLinkedListII.hpp"
 #include "../leetcode-cc/ReverseNodesinKGroup.hpp"
@@ -757,5 +758,10 @@ const int registerAll(std::shared_ptr<Container> handle) {
   handle->registerSolution(
       []() -> ArcSolution { return std::make_shared<SBSTIterator>(); });
 
+  handle->registerProblem(
+      []() -> ArcProblem { return std::make_shared<PRepeatedDNASeq>(); });
+  handle->registerSolution(
+      []() -> ArcSolution { return std::make_shared<SRepeatedDNASeq>(); });
+
   return 0;
 }