Skip to content
New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

Sign up for GitHub

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

Updated fasta_ltrretriever_lai subworkflow from upstream #111

Merged
merged 1 commit into from
Jul 23, 2024
Merged

Updated fasta_ltrretriever_lai subworkflow from upstream #111

Show file tree
Hide file tree
Changes from all commits
Commits
Show all changes
1 commit
Select commit
File filter

Filter by extension

Filter by extension
Conversations
Failed to load comments.
Loading
Jump to
Jump to file
Failed to load files.
Loading
Diff view
Diff view
14 changes: 14 additions & 0 deletions .editorconfig
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -39,6 +39,20 @@ insert_final_newline = unset
trim_trailing_whitespace = unset
indent_style = unset

# These files are edited and tested upstream in gallvp/modules
[/modules/gallvp/**]
charset = unset
end_of_line = unset
insert_final_newline = unset
trim_trailing_whitespace = unset
indent_style = unset
[/subworkflows/gallvp/**]
charset = unset
end_of_line = unset
insert_final_newline = unset
trim_trailing_whitespace = unset
indent_style = unset

[/assets/email*]
indent_size = unset

Expand Down
8 changes: 3 additions & 5 deletions CHANGELOG.md
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -11,11 +11,9 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0
2. Added min. system requirements [#91](https://github.com/Plant-Food-Research-Open/assemblyqc/issues/91)
3. Updated modules: `UNTAR`, `MERYL_COUNT`, `GUNZIP`, `MINIMAP2_ALIGN`
4. Added a test to verify the fix for the bug which resulted in a pipeline crash for assemblies without LTRs
5. Locally patched `FASTA_LTRRETRIEVER_LAI` sub-workflow to emit the `LTRRETRIEVER_LTRRETRIEVER` log as one of the outputs
6. Locally patched `LTRRETRIEVER_LTRRETRIEVER` module to not fail when `LTR_retriever` exits with an error
7. Updated NCBI FCS GX to 0.5.4 [#93](https://github.com/Plant-Food-Research-Open/assemblyqc/issues/93)
8. Updated `SYRI` to 1.7.0 [#104](https://github.com/Plant-Food-Research-Open/assemblyqc/issues/104)
9. Added a script to automatically check for updates on GitHub/GitLab and post issues
5. Updated NCBI FCS GX to 0.5.4 [#93](https://github.com/Plant-Food-Research-Open/assemblyqc/issues/93)
6. Updated `SYRI` to 1.7.0 [#104](https://github.com/Plant-Food-Research-Open/assemblyqc/issues/104)
7. Added a script to automatically check for updates on GitHub/GitLab and post issues

### `Fixed`

Expand Down
84 changes: 44 additions & 40 deletions modules.json
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -5,12 +5,56 @@
"https://github.com/GallVp/nxf-components.git": {
"modules": {
"gallvp": {
"cat/cat": {
"branch": "main",
"git_sha": "490f8ab54c632d84f99edd6f208305ac5e283ab3",
"installed_by": ["fasta_ltrretriever_lai"]
},
"custom/restoregffids": {
"branch": "main",
"git_sha": "490f8ab54c632d84f99edd6f208305ac5e283ab3",
"installed_by": ["fasta_ltrretriever_lai"]
},
"custom/shortenfastaids": {
"branch": "main",
"git_sha": "490f8ab54c632d84f99edd6f208305ac5e283ab3",
"installed_by": ["fasta_ltrretriever_lai"]
},
"ltrfinder": {
"branch": "main",
"git_sha": "db7fb043c5557cf06a49a1edbed16e282a7dffb2",
"installed_by": ["fasta_ltrretriever_lai"]
},
"ltrharvest": {
"branch": "main",
"git_sha": "db7fb043c5557cf06a49a1edbed16e282a7dffb2",
"installed_by": ["fasta_ltrretriever_lai"]
},
"ltrretriever/lai": {
"branch": "main",
"git_sha": "490f8ab54c632d84f99edd6f208305ac5e283ab3",
"installed_by": ["fasta_ltrretriever_lai"]
},
"ltrretriever/ltrretriever": {
"branch": "main",
"git_sha": "490f8ab54c632d84f99edd6f208305ac5e283ab3",
"installed_by": ["fasta_ltrretriever_lai"]
},
"syri": {
"branch": "main",
"git_sha": "836bb223521eeaa08d65c1b7f4b82be1272a1964",
"installed_by": ["modules"]
}
}
},
"subworkflows": {
"gallvp": {
"fasta_ltrretriever_lai": {
"branch": "main",
"git_sha": "490f8ab54c632d84f99edd6f208305ac5e283ab3",
"installed_by": ["subworkflows"]
}
}
}
},
"https://github.com/PlantandFoodResearch/nxf-modules.git": {
Expand All @@ -36,26 +80,11 @@
"git_sha": "d158062346649b5d55bccef77f4bbd0468760aff",
"installed_by": ["fastq_bwa_mem_samblaster"]
},
"cat/cat": {
"branch": "main",
"git_sha": "10b046eaac396f279c08e7e2bb067482ccd9c74e",
"installed_by": ["fasta_ltrretriever_lai"]
},
"custom/relabelfasta": {
"branch": "main",
"git_sha": "0421bdeb1d7a71dce12e0af7dc18aea26e548074",
"installed_by": ["modules"]
},
"custom/restoregffids": {
"branch": "main",
"git_sha": "da7a50af5eaac9601e23f33e00bf24e61f9c27ab",
"installed_by": ["fasta_ltrretriever_lai"]
},
"custom/shortenfastaids": {
"branch": "main",
"git_sha": "e9ec2e4c48ead3d760c8e13950c568c19ae86b8b",
"installed_by": ["fasta_ltrretriever_lai"]
},
"gffread": {
"branch": "main",
"git_sha": "c3ef9317fe867609f5927588fbf17e3c3ebf389c",
Expand All @@ -76,26 +105,6 @@
"git_sha": "ffd39a616c84c814fdfb2a865e9fbbb06e5343d9",
"installed_by": ["gff3_gt_gff3_gff3validator_stat", "modules"]
},
"ltrfinder": {
"branch": "main",
"git_sha": "10b046eaac396f279c08e7e2bb067482ccd9c74e",
"installed_by": ["fasta_ltrretriever_lai"]
},
"ltrharvest": {
"branch": "main",
"git_sha": "10b046eaac396f279c08e7e2bb067482ccd9c74e",
"installed_by": ["fasta_ltrretriever_lai"]
},
"ltrretriever/lai": {
"branch": "main",
"git_sha": "10b046eaac396f279c08e7e2bb067482ccd9c74e",
"installed_by": ["fasta_ltrretriever_lai"]
},
"ltrretriever/ltrretriever": {
"branch": "main",
"git_sha": "10b046eaac396f279c08e7e2bb067482ccd9c74e",
"installed_by": ["fasta_ltrretriever_lai"]
},
"merqury/hapmers": {
"branch": "main",
"git_sha": "46b70684b6ae0ac60cae154c61796b293707db64",
Expand Down Expand Up @@ -125,11 +134,6 @@
"git_sha": "0e4afaff4964485d2d93f1115c5254a99765b9c1",
"installed_by": ["subworkflows"]
},
"fasta_ltrretriever_lai": {
"branch": "main",
"git_sha": "e9ec2e4c48ead3d760c8e13950c568c19ae86b8b",
"installed_by": ["subworkflows"]
},
"fastq_bwa_mem_samblaster": {
"branch": "main",
"git_sha": "d158062346649b5d55bccef77f4bbd0468760aff",
Expand Down
0 modules/pfr/cat/cat/environment.yml → modules/gallvp/cat/cat/environment.yml
View file
Open in desktop
File renamed without changes.
1 change: 0 additions & 1 deletion modules/pfr/cat/cat/main.nf → modules/gallvp/cat/cat/main.nf
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -76,4 +76,3 @@ def getFileSuffix(filename) {
def match = filename =~ /^.*?((\.\w{1,5})?(\.\w{1,5}\.gz$))/
return match ? match[0][1] : filename.substring(filename.lastIndexOf('.'))
}

0 modules/pfr/cat/cat/meta.yml → modules/gallvp/cat/cat/meta.yml
View file
Open in desktop
File renamed without changes.
31 changes: 22 additions & 9 deletions modules/pfr/cat/cat/tests/main.nf.test → modules/gallvp/cat/cat/tests/main.nf.test
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -4,7 +4,7 @@ nextflow_process {
script "../main.nf"
process "CAT_CAT"
tag "modules"
tag "modules_nfcore"
tag "modules_gallvp"
tag "cat"
tag "cat/cat"

Expand All @@ -29,7 +29,8 @@ nextflow_process {
then {
assertAll(
{ assert !process.success },
{ assert process.stdout.toString().contains("The name of the input file can't be the same as for the output prefix") }
{ assert process.stdout.toString().contains("The name of the input file can't be the same as for the output prefix") },
{ assert snapshot(process.out.versions).match() }
)
}
}
Expand Down Expand Up @@ -83,8 +84,12 @@ nextflow_process {
def lines = path(process.out.file_out.get(0).get(1)).linesGzip
assertAll(
{ assert process.success },
{ assert snapshot(lines[0..5]).match("test_cat_zipped_zipped_lines") },
{ assert snapshot(lines.size()).match("test_cat_zipped_zipped_size")}
{ assert snapshot(
lines[0..5],
lines.size(),
process.out.versions
).match()
}
)
}
}
Expand Down Expand Up @@ -142,8 +147,12 @@ nextflow_process {
def lines = path(process.out.file_out.get(0).get(1)).linesGzip
assertAll(
{ assert process.success },
{ assert snapshot(lines[0..5]).match("test_cat_unzipped_zipped_lines") },
{ assert snapshot(lines.size()).match("test_cat_unzipped_zipped_size")}
{ assert snapshot(
lines[0..5],
lines.size(),
process.out.versions
).match()
}
)
}
}
Expand All @@ -170,9 +179,13 @@ nextflow_process {
def lines = path(process.out.file_out.get(0).get(1)).linesGzip
assertAll(
{ assert process.success },
{ assert snapshot(lines[0..5]).match("test_cat_one_file_unzipped_zipped_lines") },
{ assert snapshot(lines.size()).match("test_cat_one_file_unzipped_zipped_size")}
{ assert snapshot(
lines[0..5],
lines.size(),
process.out.versions
).match()
}
)
}
}
}
}
74 changes: 50 additions & 24 deletions modules/pfr/cat/cat/tests/main.nf.test.snap → ...es/gallvp/cat/cat/tests/main.nf.test.snap
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -1,10 +1,4 @@
{
"test_cat_unzipped_zipped_size": {
"content": [
375
],
"timestamp": "2023-10-16T14:33:08.049445686"
},
"test_cat_unzipped_unzipped": {
"content": [
{
Expand Down Expand Up @@ -34,6 +28,10 @@
]
}
],
"meta": {
"nf-test": "0.8.4",
"nextflow": "24.04.3"
},
"timestamp": "2023-10-16T14:32:18.500464399"
},
"test_cat_zipped_unzipped": {
Expand Down Expand Up @@ -65,9 +63,13 @@
]
}
],
"meta": {
"nf-test": "0.8.4",
"nextflow": "24.04.3"
},
"timestamp": "2023-10-16T14:32:49.642741302"
},
"test_cat_zipped_zipped_lines": {
"test_cat_zipped_zipped": {
"content": [
[
"MT192765.1\tGenbank\ttranscript\t259\t29667\t.\t+\t.\tID=unknown_transcript_1;geneID=orf1ab;gene_name=orf1ab",
Expand All @@ -76,11 +78,31 @@
"MT192765.1\tGenbank\tCDS\t13461\t21548\t.\t+\t0\tParent=unknown_transcript_1;exception=\"ribosomal slippage\";gbkey=CDS;gene=orf1ab;note=\"pp1ab;translated=by -1 ribosomal frameshift\";product=\"orf1ab polyprotein\";protein_id=QIK50426.1",
"MT192765.1\tGenbank\tCDS\t21556\t25377\t.\t+\t0\tParent=unknown_transcript_1;gbkey=CDS;gene=S;note=\"structural protein\";product=\"surface glycoprotein\";protein_id=QIK50427.1",
"MT192765.1\tGenbank\tgene\t21556\t25377\t.\t+\t.\tParent=unknown_transcript_1"
],
78,
[
"versions.yml:md5,115ed6177ebcff24eb99d503fa5ef894"
]
],
"meta": {
"nf-test": "0.8.4",
"nextflow": "24.04.3"
},
"timestamp": "2024-07-22T11:51:46.802978"
},
"test_cat_name_conflict": {
"content": [
[

]
],
"timestamp": "2023-10-16T14:32:33.629048645"
"meta": {
"nf-test": "0.8.4",
"nextflow": "24.04.3"
},
"timestamp": "2024-07-22T11:51:29.45394"
},
"test_cat_unzipped_zipped_lines": {
"test_cat_one_file_unzipped_zipped": {
"content": [
[
">MT192765.1 Severe acute respiratory syndrome coronavirus 2 isolate SARS-CoV-2/human/USA/PC00101P/2020, complete genome",
Expand All @@ -89,11 +111,19 @@
"TAACTCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTTTGTCCGG",
"GTGTGACCGAAAGGTAAGATGGAGAGCCTTGTCCCTGGTTTCAACGAGAAAACACACGTCCAACTCAGTTTGCCTGTTTT",
"ACAGGTTCGCGACGTGCTCGTACGTGGCTTTGGAGACTCCGTGGAGGAGGTCTTATCAGAGGCACGTCAACATCTTAAAG"
],
374,
[
"versions.yml:md5,115ed6177ebcff24eb99d503fa5ef894"
]
],
"timestamp": "2023-10-16T14:33:08.038830506"
"meta": {
"nf-test": "0.8.4",
"nextflow": "24.04.3"
},
"timestamp": "2024-07-22T11:52:02.774016"
},
"test_cat_one_file_unzipped_zipped_lines": {
"test_cat_unzipped_zipped": {
"content": [
[
">MT192765.1 Severe acute respiratory syndrome coronavirus 2 isolate SARS-CoV-2/human/USA/PC00101P/2020, complete genome",
Expand All @@ -102,20 +132,16 @@
"TAACTCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTTTGTCCGG",
"GTGTGACCGAAAGGTAAGATGGAGAGCCTTGTCCCTGGTTTCAACGAGAAAACACACGTCCAACTCAGTTTGCCTGTTTT",
"ACAGGTTCGCGACGTGCTCGTACGTGGCTTTGGAGACTCCGTGGAGGAGGTCTTATCAGAGGCACGTCAACATCTTAAAG"
],
375,
[
"versions.yml:md5,115ed6177ebcff24eb99d503fa5ef894"
]
],
"timestamp": "2023-10-16T14:33:21.39642399"
},
"test_cat_zipped_zipped_size": {
"content": [
78
],
"timestamp": "2023-10-16T14:32:33.641869244"
},
"test_cat_one_file_unzipped_zipped_size": {
"content": [
374
],
"timestamp": "2023-10-16T14:33:21.4094373"
"meta": {
"nf-test": "0.8.4",
"nextflow": "24.04.3"
},
"timestamp": "2024-07-22T11:51:57.581523"
}
}
0 ...cat/tests/nextflow_unzipped_zipped.config → ...cat/tests/nextflow_unzipped_zipped.config
View file
Open in desktop
File renamed without changes.
0 ...cat/tests/nextflow_zipped_unzipped.config → ...cat/tests/nextflow_zipped_unzipped.config
View file
Open in desktop
File renamed without changes.
0 modules/pfr/cat/cat/tests/tags.yml → modules/gallvp/cat/cat/tests/tags.yml
View file
Open in desktop
File renamed without changes.
0 .../pfr/custom/restoregffids/environment.yml → ...llvp/custom/restoregffids/environment.yml
View file
Open in desktop
File renamed without changes.
0 modules/pfr/custom/restoregffids/main.nf → modules/gallvp/custom/restoregffids/main.nf
View file
Open in desktop
File renamed without changes.
0 modules/pfr/custom/restoregffids/meta.yml → modules/gallvp/custom/restoregffids/meta.yml
View file
Open in desktop
File renamed without changes.
0 ...estoregffids/templates/restore_gff_ids.py → ...estoregffids/templates/restore_gff_ids.py
View file
Open in desktop
File renamed without changes.
6 changes: 3 additions & 3 deletions ...r/custom/restoregffids/tests/main.nf.test → ...p/custom/restoregffids/tests/main.nf.test
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -5,7 +5,7 @@ nextflow_process {
process "CUSTOM_RESTOREGFFIDS"

tag "modules"
tag "modules_nfcore"
tag "modules_gallvp"
tag "custom"
tag "custom/restoregffids"

Expand All @@ -15,7 +15,7 @@ nextflow_process {
"""
input[0] = [
[ id:'test', single_end:false ], // meta map
file(params.test_data['sarscov2']['genome']['genome_gff3'], checkIfExists: true)
file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.gff3', checkIfExists: true)
]
input[1] = Channel.of('Chr1\tMT192765.1').collectFile(name: 'id_map.tsv', newLine: true)
"""
Expand Down Expand Up @@ -43,7 +43,7 @@ nextflow_process {
"""
input[0] = [
[ id:'test', single_end:false ], // meta map
file(params.test_data['sarscov2']['genome']['genome_gff3'], checkIfExists: true)
file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.gff3', checkIfExists: true)
]
input[1] = Channel.of('Chr1\tMT192765.1').collectFile(name: 'id_map.tsv', newLine: true)
"""
Expand Down
0 ...tom/restoregffids/tests/main.nf.test.snap → ...tom/restoregffids/tests/main.nf.test.snap
View file
Open in desktop
File renamed without changes.
0 ...fr/custom/shortenfastaids/environment.yml → ...vp/custom/shortenfastaids/environment.yml
View file
Open in desktop
File renamed without changes.
0 modules/pfr/custom/shortenfastaids/main.nf → ...les/gallvp/custom/shortenfastaids/main.nf
View file
Open in desktop
File renamed without changes.
0 modules/pfr/custom/shortenfastaids/meta.yml → ...es/gallvp/custom/shortenfastaids/meta.yml
View file
Open in desktop
File renamed without changes.
Loading