TP final Bioinformática

How to install the cli

1. Update your local system's repository list by entering the following command:
   • sudo apt update
2. Install python
   • sudo apt install python3
3. Install pip.
   • sudo apt install python3-pip
4. Install bio python (version 1.79). The script will probably works with later versions, but we recommened installing the metioned one. Moreover, the whole package is not needed. The script only uses Bio.Blast and Bio.Entrez. So feel free to install only those two modules if you want.
   • pip install biopython==1.79
5. Install blast local -> https://ftp.ncbi.nlm.nih.gov/blast/executables/LATEST/
   • sudo apt install ncbi-blast+
6. Clone the github repo
   • git clone https://github.com/BioinformaticaUNQ/homo_mirarns-emilianaAilen.git
7. Extract the files from db.zip and db2.zip files into the repo root directory

How to use the cli

1. Open a terminal within the repo root directory
2. Create a file with your fasta sequence / gene id number.
3. Type the following command: python3 Library.py [PARAMETERS]
4. After running the script a filed called "result.txt" will be generated in the same directory (this is the deafult outpout name, but it could be changed)

The parameters you can use are the followings:

Parameter name	Type	Required	Description
'-p', '--path'	String	True	Gene ID number or path to file which contains fasta sequence (depending on the serching type)
'-t', '--type'	String	True	Searching method. Must be one of these: 'FASTA', 'MIRNA_FASTA', 'GENE_ID'
'-s', '--specie'	String	True	Target specie
'-d', '--db'	String	False	miARNs db where the searching will be performed. Must be one of these: 'RUMIMIR', 'MIRNEST', 'MIRBASE', 'TARBASE'
'-e', '--evalue	Float	False	Maximum e-value (default=0.05)
'-i', '--percentage'	String	False	Minimun identity percentage (default=40.0)
'-z', '--entrezdb'	String	False	Entrez db to perform gene id serachings (default='nucleotide')
'-m', '--entrezemail'	String	True	Email account for entrez configuration
'-o', '--output'	String	False	Output file path (default='result.txt')
'-b', '--blastdb'	String	False	Blast nucleotide target database. This parameter is used to perform a blast seraching when the script searching method is "FASTA" or "MIRNA_FASTA" (default='nt')

Use Cases

MIRNA_FASTA case:

Command:

python3 get_mirnas.py --path './chr1_2303_mature.fasta' --type MIRNA_FASTA --specie 'lin' --db RUMIMIR --evalue 0.005 --percentage 50.0 -m '[email protected]'

The input file should contain something like:

> Rum-oar-00023#chr1_2303_mature@@hsa-miR-138-2-3p#Adipose_tissue
UGGUGUCGUGAUGCUCU

GENE_ID case:

python3 get_mirnas.py --path '241989491' --type GENE_ID --specie 'Oryza sativa' --db MIRNEST --evalue 0.005 --percentage 50.0 -m '[email protected]'

FASTA case:

python3 get_mirnas.py --path './secuence.genome.fas' --type FASTA --specie 'Oryza sativa' --db MIRNEST --evalue 0.005 --percentage 50.0 -m '[email protected]'

The input file should contain something like:

> ADN query
GTGCATTAGACTACATGTTTAGTGATAACAGCCTTGTTACTGCTATTATCATTATTATTATTATAAGATTGGCAGATGGCACCCTTGGTTAGAACATTGGACAAACTGCCTTACAACACTTTCCCTACAATGTTCAAATCCCACTGGTGTCAACTTAACCTTTCATCCTTCTTGGCTCAATAAACATCTGATTGGCCCTTTACCACTAAAATATTTGGGGTTACATGGATTCACTACACAAATTTGTGACCTTAAGCCAATATAAGGAAACATTGTTTCTATTATGTTTATAATTAAATTCGCTGTTGCTGGTATTGTTATTTACTGCTGCAGTCTTCTATAAATTATATTATCTAATAATAATAATAATAATAATAATTAAGATATTAATAATGGTTTCACATTTTGGCACAAAGCCTACAAGTTCGTGGGAGGGGGTAAGTTGATAATATCAACCACAGTGCTCAACTAGTAATTGTTTTATCAACGCTGAAAGGATAAGTCAATCCCAGCAGCATCTGAACTCGGAATGTAAAGTTGGAAGAAATACTGCTAAGCATTTTGTCTGGAACGGTAATGATTCTGCCAGATTGCTGCCTTAATAATAATAATGATGATGATGATGATGATGATGATAATAATAATAAAAAATAATAATAATGATCATAATAACTAAGCTTATATATATATATACATAAATTTATTTATGTATAACTATTTATATTTATATTTAATTATTACAAACTACTTGGATGTAATTAAATTTCTTTTAAAATT

Run tests

Open a terminal in the root directory and run the following command python -m unittest discover .