release 2.2.7 commits.

MANUAL

@@ -304,11 +304,11 @@ reference.
 For an alignment to be considered "valid" (i.e. "good enough") by Bowtie 2, it
 must have an alignment score no less than the minimum score threshold.  The
 threshold is configurable and is expressed as a function of the read length. In
-end-to-end alignment mode, the default minimum score threhsold is `-0.6 + -0.6 *
-L`, where `L` is the read length.  In local alignment mdoe, the default minimum
+end-to-end alignment mode, the default minimum score threshold is `-0.6 + -0.6 *
+L`, where `L` is the read length.  In local alignment mode, the default minimum
 score threshold is `20 + 8.0 * ln(L)`, where L is the read length.  This can be
 configured with the `--score-min` option.  For details on how to set options
-like `--score-min` that correpond to functions, see the section on [setting
+like `--score-min` that correspond to functions, see the section on [setting
 function options].
 
 Mapping quality: higher = more unique
@@ -419,16 +419,16 @@ alignment status of pairs per se, not individual mates.
 
 The SAM `FLAGS` field, the second field in a SAM record, has multiple bits that
 describe the paired-end nature of the read and alignment.  The first (least
-significant) bit (1 in decimal, 0x1 in hexidecimal) is set if the read is part
-of a pair.  The second bit (2 in decimal, 0x2 in hexidecimal) is set if the read
+significant) bit (1 in decimal, 0x1 in hexadecimal) is set if the read is part
+of a pair.  The second bit (2 in decimal, 0x2 in hexadecimal) is set if the read
 is part of a pair that aligned in a paired-end fashion.  The fourth bit (8 in
-decimal, 0x8 in hexidecimal) is set if the read is part of a pair and the other
+decimal, 0x8 in hexadecimal) is set if the read is part of a pair and the other
 mate in the pair had at least one valid alignment.  The sixth bit (32 in
-decimal, 0x20 in hexidecimal) is set if the read is part of a pair and the other
+decimal, 0x20 in hexadecimal) is set if the read is part of a pair and the other
 mate in the pair aligned to the Crick strand (or, equivalently, if the reverse
 complement of the other mate aligned to the Watson strand).  The seventh bit (64
-in decimal, 0x40 in hexidecimal) is set if the read is mate 1 in a pair.  The
-eighth bit (128 in decimal, 0x80 in hexidecimal) is set if the read is mate 2 in
+in decimal, 0x40 in hexadecimal) is set if the read is mate 1 in a pair.  The
+eighth bit (128 in decimal, 0x80 in hexadecimal) is set if the read is mate 2 in
 a pair.  See the [SAM specification] for a more detailed description of the
 `FLAGS` field.
 
@@ -523,7 +523,7 @@ because it exceeded a limit placed on search effort (see `-D` and `-R`) or
 because it already knows all it needs to know to report an alignment.
 Information from the best alignments are used to estimate mapping quality (the
 `MAPQ` [SAM] field) and to set SAM optional fields, such as `AS:i` and
-`XS:i`.  Bowtie 2 does not garantee that the alignment reported is the best
+`XS:i`.  Bowtie 2 does not guarantee that the alignment reported is the best
 possible in terms of alignment score.
 
 See also: `-D`, which puts an upper limit on the number of dynamic programming
@@ -678,7 +678,7 @@ ambiguous nucleotides.  Bowtie 2 will still print a SAM record for such a read,
 but no alignment will be reported and and the `YF:i` SAM optional field will be
 set to indicate the reason the read was filtered.
 
-* `YF:Z:LN`: the read was filtered becuase it had length less than or equal to
+* `YF:Z:LN`: the read was filtered because it had length less than or equal to
 the number of seed mismatches set with the `-N` option.
 * `YF:Z:NS`: the read was filtered because it contains a number of ambiguous
 characters (usually `N` or `.`) greater than the ceiling specified with
@@ -978,14 +978,14 @@ alignment].  Can be set to 0 or 1. Setting this higher makes alignment slower
     -L <int>
 
 Sets the length of the seed substrings to align during [multiseed alignment].
-Smaller values make alignment slower but more senstive. Default: the
+Smaller values make alignment slower but more sensitive. Default: the
 `--sensitive` preset is used by default, which sets `-L` to 20 both in
 `--end-to-end` mode and in `--local` mode.
 
     -i <func>
 
 Sets a function governing the interval between seed substrings to use during
-[multiseed alignment].  For instance, if the read has 30 characers, and seed
+[multiseed alignment].  For instance, if the read has 30 characters, and seed
 length is 10, and the seed interval is 6, the seeds extracted will be:
 
     Read:      TAGCTACGCTCTACGCTATCATGCATAAAC
@@ -1462,7 +1462,7 @@ When one or more `--rg` arguments are specified, `bowtie2` will also print
 an `@RG` line that includes all user-specified `--rg` tokens separated by
 tabs.
 
-Each subsequnt line describes an alignment or, if the read failed to align, a
+Each subsequent line describes an alignment or, if the read failed to align, a
 read.  Each line is a collection of at least 12 fields separated by tabs; from
 left to right, the fields are:
 

doc/website/manual.ssi

@@ -1330,4 +1330,3 @@ r7  16  gi|9626243|ref|NC_001416.1| 4692    42  143M    *   0   0   TCAGCCGGACGC
 <p>Then to view the variants, run:</p>
 <pre><code>bcftools view eg2.raw.bcf</code></pre>
 <p>See the official SAMtools guide to <a href="http://samtools.sourceforge.net/mpileup.shtml">Calling SNPs/INDELs with SAMtools/BCFtools</a> for more details and variations on this process.</p>
-

doc/website/old_news.ssi

@@ -3,6 +3,29 @@
    <li>Bowtie 2 source now lives in a <a href="https://github.com/BenLangmead/bowtie2">public GitHub repository</a>.</li>
 </ul>
 
+<h2>Version 2.2.0 - February 17, 2014</h2>
+<ul>
+   <li>Improved index querying efficiency using "population count"
+       instructions available since
+       <a href="http://en.wikipedia.org/wiki/SSE4.2#SSE4.2">SSE4.2</a></li>
+   <li>Added support for large and small indexes, removing 4-billion-nucleotide
+       barrier. Bowtie 2 can now be used with reference genomes of any size.</li>
+   <li>Fixed bug that could cause bowtie2-build to crash when reference length
+       is close to 4 billion.</li>
+   <li>Added a <tt>CL:</tt> string to the <tt>@PG</tt> SAM header to preserve information about
+       the aligner binary and paramteres.</li>
+   <li>Fixed bug that could cause <tt>bowtie2-build</tt> to crash when reference length
+       is close to 4 billion.</li>
+   <li>No longer releasing 32-bit binaries. Simplified manual and Makefile
+       accordingly.</li>
+   <li>Credits to the Intel&reg; enabling team for performance optimizations
+       included in this release. Thank you!</li>
+   <li>Phased out CygWin support. MinGW can still be used for Windows building.</li>
+   <li>Added the .bat generation for Windows.</li>
+   <li>Fixed some issues with some uncommon chars in fasta files.</li>
+   <li>Fixed wrappers so bowtie can now be used with symlinks.</li>
+</ul>
+
 <h2>Version 2.1.0 - February 21, 2013</h2>
 <ul>
    <li>Improved multithreading support so that Bowtie 2 now uses native Windows

doc/website/recent_news.ssi

@@ -1,6 +1,14 @@
 
 <h2>Bowtie2 developers note</h2>
 <p>As of Nov 2015 we had to fix the bowtie2 github repo and relabel the entire history. Developers and contributors should re-clone the bowtie2 github repo from this current state. </p>
+<h2>Version 2.2.7 - Feb 10, 2016</h2>
+<ul>
+   <li>Added a parallel index build option: bowtie2-build --threads <# threads>.</li>
+   <li>Fixed an issue whereby IUPAC codes (other than A/C/G/T/N) in reads were converted to As. Now all non-A/C/G/T characters in reads become Ns.</li>
+   <li>Fixed some compilation issues, including for the Intel C++ Compiler.</li>
+   <li>Removed debugging code that could impede performance for many alignment threads.</li>
+   <li>Fixed a few typos in documentation.</li>
+</ul>
 <h2>Version 2.2.6 - Jul 22, 2015</h2>
 <ul>
    <li>Switched to a stable sort to avoid some potential reproducibility confusions.</li>
@@ -71,27 +79,5 @@
      governing the multiseed heuristic.</li>
 </ul>
 
-<h2>Version 2.2.0 - February 17, 2014</h2>
-<ul>
-   <li>Improved index querying efficiency using "population count"
-       instructions available since
-       <a href="http://en.wikipedia.org/wiki/SSE4.2#SSE4.2">SSE4.2</a></li>
-   <li>Added support for large and small indexes, removing 4-billion-nucleotide
-       barrier. Bowtie 2 can now be used with reference genomes of any size.</li>
-   <li>Fixed bug that could cause bowtie2-build to crash when reference length
-       is close to 4 billion.</li>
-   <li>Added a <tt>CL:</tt> string to the <tt>@PG</tt> SAM header to preserve information about
-       the aligner binary and paramteres.</li>
-   <li>Fixed bug that could cause <tt>bowtie2-build</tt> to crash when reference length
-       is close to 4 billion.</li>
-   <li>No longer releasing 32-bit binaries. Simplified manual and Makefile
-       accordingly.</li>
-   <li>Credits to the Intel&reg; enabling team for performance optimizations
-       included in this release. Thank you!</li>
-   <li>Phased out CygWin support. MinGW can still be used for Windows building.</li>
-   <li>Added the .bat generation for Windows.</li>
-   <li>Fixed some issues with some uncommon chars in fasta files.</li>
-   <li>Fixed wrappers so bowtie can now be used with symlinks.</li>
-</ul>
 
 

doc/website/rhsidebar.ssi

@@ -15,10 +15,10 @@
      <table width="100%">
       <tr>
       <td>
-        <a href="https://sourceforge.net/projects/bowtie-bio/files/bowtie2/2.2.6">Bowtie2 2.2.6</a>
+        <a href="https://sourceforge.net/projects/bowtie-bio/files/bowtie2/2.2.7">Bowtie2 2.2.7</a>
       </td>
       <td align="right">
-        7/22/15&nbsp;
+        2/10/16&nbsp;
       </td>
       </tr>
       <tr>