Prepare release 2.2.9

MANUAL

@@ -1781,6 +1781,11 @@ sequences) and ignore the rest.
 `bowtie2-build` is verbose by default.  With this option `bowtie2-build` will
 print only error messages.
 
+    --threads <int>
+
+By default `bowtie2-build` is using only one thread. Increasing the number
+of threads will speed up the index building considerably in most cases.
+
     -h/--help
 
 Print usage information and quit.

NEWS

@@ -16,6 +16,10 @@ Please report any issues using the Sourceforge bug tracker:
 Version Release History
 =======================
 
+Version 2.2.9 - Apr 22, 2016
+   * Fixed the multiple threads issue for the bowtie2-build.
+   * Fixed a TBB related build issue impacting TBB v4.4.
+
 Version 2.2.8 - Mar 10, 2016
    * Various website updates.
    * Fixed the bowtie2-build issue that made TBB compilation fail.

VERSION

@@ -1 +1 @@
-2.2.8
+2.2.9

doc/manual.html

@@ -168,7 +168,7 @@ <h3 id="local-alignment-score-example">Local alignment score example</h3>
 <p>A mismatched base at a high-quality position in the read receives a penalty of -6 by default. A length-2 read gap receives a penalty of -11 by default (-5 for the gap open, -3 for the first extension, -3 for the second extension). A base that matches receives a bonus of +2 be default. Thus, in local alignment mode, if the read is 50 bp long and it matches the reference exactly except for one mismatch at a high-quality position and one length-2 read gap, then the overall score equals the total bonus, 2 * 49, minus the total penalty, 6 + 11, = 81.</p>
 <p>The best possible score in local mode equals the match bonus times the length of the read. This happens when there are no differences between the read and the reference.</p>
 <h3 id="valid-alignments-meet-or-exceed-the-minimum-score-threshold">Valid alignments meet or exceed the minimum score threshold</h3>
-<p>For an alignment to be considered &quot;valid&quot; (i.e. &quot;good enough&quot;) by Bowtie 2, it must have an alignment score no less than the minimum score threshold. The threshold is configurable and is expressed as a function of the read length. In end-to-end alignment mode, the default minimum score threhsold is <code>-0.6 + -0.6 * L</code>, where <code>L</code> is the read length. In local alignment mdoe, the default minimum score threshold is <code>20 + 8.0 * ln(L)</code>, where L is the read length. This can be configured with the <a href="#bowtie2-options-score-min"><code>--score-min</code></a> option. For details on how to set options like <code>--score-min</code> that correpond to functions, see the section on <a href="#setting-function-options">setting function options</a>.</p>
+<p>For an alignment to be considered &quot;valid&quot; (i.e. &quot;good enough&quot;) by Bowtie 2, it must have an alignment score no less than the minimum score threshold. The threshold is configurable and is expressed as a function of the read length. In end-to-end alignment mode, the default minimum score threshold is <code>-0.6 + -0.6 * L</code>, where <code>L</code> is the read length. In local alignment mode, the default minimum score threshold is <code>20 + 8.0 * ln(L)</code>, where L is the read length. This can be configured with the <a href="#bowtie2-options-score-min"><code>--score-min</code></a> option. For details on how to set options like <code>--score-min</code> that correspond to functions, see the section on <a href="#setting-function-options">setting function options</a>.</p>
 <h2 id="mapping-quality-higher-more-unique">Mapping quality: higher = more unique</h2>
 <p>The aligner cannot always assign a read to its point of origin with high confidence. For instance, a read that originated inside a repeat element might align equally well to many occurrences of the element throughout the genome, leaving the aligner with no basis for preferring one over the others.</p>
 <p>Aligners characterize their degree of confidence in the point of origin by reporting a mapping quality: a non-negative integer Q = -10 log10 p, where p is an estimate of the probability that the alignment does not correspond to the read's true point of origin. Mapping quality is sometimes abbreviated MAPQ, and is recorded in the <a href="http://samtools.sourceforge.net/SAM1.pdf">SAM</a> <code>MAPQ</code> field.</p>
@@ -190,7 +190,7 @@ <h3 id="mixed-mode-paired-where-possible-unpaired-otherwise">Mixed mode: paired
 <p>If Bowtie 2 cannot find a paired-end alignment for a pair, by default it will go on to look for unpaired alignments for the constituent mates. This is called &quot;mixed mode.&quot; To disable mixed mode, set the <a href="#bowtie2-options-no-mixed"><code>--no-mixed</code></a> option.</p>
 <p>Bowtie 2 runs a little faster in <code>--no-mixed</code> mode, but will only consider alignment status of pairs per se, not individual mates.</p>
 <h3 id="some-sam-flags-describe-paired-end-properties">Some SAM FLAGS describe paired-end properties</h3>
-<p>The SAM <code>FLAGS</code> field, the second field in a SAM record, has multiple bits that describe the paired-end nature of the read and alignment. The first (least significant) bit (1 in decimal, 0x1 in hexidecimal) is set if the read is part of a pair. The second bit (2 in decimal, 0x2 in hexidecimal) is set if the read is part of a pair that aligned in a paired-end fashion. The fourth bit (8 in decimal, 0x8 in hexidecimal) is set if the read is part of a pair and the other mate in the pair had at least one valid alignment. The sixth bit (32 in decimal, 0x20 in hexidecimal) is set if the read is part of a pair and the other mate in the pair aligned to the Crick strand (or, equivalently, if the reverse complement of the other mate aligned to the Watson strand). The seventh bit (64 in decimal, 0x40 in hexidecimal) is set if the read is mate 1 in a pair. The eighth bit (128 in decimal, 0x80 in hexidecimal) is set if the read is mate 2 in a pair. See the <a href="http://samtools.sourceforge.net/SAM1.pdf">SAM specification</a> for a more detailed description of the <code>FLAGS</code> field.</p>
+<p>The SAM <code>FLAGS</code> field, the second field in a SAM record, has multiple bits that describe the paired-end nature of the read and alignment. The first (least significant) bit (1 in decimal, 0x1 in hexadecimal) is set if the read is part of a pair. The second bit (2 in decimal, 0x2 in hexadecimal) is set if the read is part of a pair that aligned in a paired-end fashion. The fourth bit (8 in decimal, 0x8 in hexadecimal) is set if the read is part of a pair and the other mate in the pair had at least one valid alignment. The sixth bit (32 in decimal, 0x20 in hexadecimal) is set if the read is part of a pair and the other mate in the pair aligned to the Crick strand (or, equivalently, if the reverse complement of the other mate aligned to the Watson strand). The seventh bit (64 in decimal, 0x40 in hexadecimal) is set if the read is mate 1 in a pair. The eighth bit (128 in decimal, 0x80 in hexadecimal) is set if the read is mate 2 in a pair. See the <a href="http://samtools.sourceforge.net/SAM1.pdf">SAM specification</a> for a more detailed description of the <code>FLAGS</code> field.</p>
 <h3 id="some-sam-optional-fields-describe-more-paired-end-properties">Some SAM optional fields describe more paired-end properties</h3>
 <p>The last severeal fields of each SAM record usually contain SAM optional fields, which are simply tab-separated strings conveying additional information about the reads and alignments. A SAM optional field is formatted like this: &quot;XP:i:1&quot; where &quot;XP&quot; is the <code>TAG</code>, &quot;i&quot; is the <code>TYPE</code> (&quot;integer&quot; in this case), and &quot;1&quot; is the <code>VALUE</code>. See the <a href="http://samtools.sourceforge.net/SAM1.pdf">SAM specification</a> for details regarding SAM optional fields.</p>
 <h3 id="mates-can-overlap-contain-or-dovetail-each-other">Mates can overlap, contain, or dovetail each other</h3>
@@ -220,7 +220,7 @@ <h3 id="distinct-alignments-map-a-read-to-different-places">Distinct alignments
 <p>Two alignments for the same individual read are &quot;distinct&quot; if they map the same read to different places. Specifically, we say that two alignments are distinct if there are no alignment positions where a particular read offset is aligned opposite a particular reference offset in both alignments with the same orientation. E.g. if the first alignment is in the forward orientation and aligns the read character at read offset 10 to the reference character at chromosome 3, offset 3,445,245, and the second alignment is also in the forward orientation and also aligns the read character at read offset 10 to the reference character at chromosome 3, offset 3,445,245, they are not distinct alignments.</p>
 <p>Two alignments for the same pair are distinct if either the mate 1s in the two paired-end alignments are distinct or the mate 2s in the two alignments are distinct or both.</p>
 <h3 id="default-mode-search-for-multiple-alignments-report-the-best-one">Default mode: search for multiple alignments, report the best one</h3>
-<p>By default, Bowtie 2 searches for distinct, valid alignments for each read. When it finds a valid alignment, it generally will continue to look for alignments that are nearly as good or better. It will eventually stop looking, either because it exceeded a limit placed on search effort (see <a href="#bowtie2-options-D"><code>-D</code></a> and <a href="#bowtie2-options-R"><code>-R</code></a>) or because it already knows all it needs to know to report an alignment. Information from the best alignments are used to estimate mapping quality (the <code>MAPQ</code> <a href="http://samtools.sourceforge.net/SAM1.pdf">SAM</a> field) and to set SAM optional fields, such as <a href="#bowtie2-build-opt-fields-as"><code>AS:i</code></a> and <a href="#bowtie2-build-opt-fields-xs"><code>XS:i</code></a>. Bowtie 2 does not garantee that the alignment reported is the best possible in terms of alignment score.</p>
+<p>By default, Bowtie 2 searches for distinct, valid alignments for each read. When it finds a valid alignment, it generally will continue to look for alignments that are nearly as good or better. It will eventually stop looking, either because it exceeded a limit placed on search effort (see <a href="#bowtie2-options-D"><code>-D</code></a> and <a href="#bowtie2-options-R"><code>-R</code></a>) or because it already knows all it needs to know to report an alignment. Information from the best alignments are used to estimate mapping quality (the <code>MAPQ</code> <a href="http://samtools.sourceforge.net/SAM1.pdf">SAM</a> field) and to set SAM optional fields, such as <a href="#bowtie2-build-opt-fields-as"><code>AS:i</code></a> and <a href="#bowtie2-build-opt-fields-xs"><code>XS:i</code></a>. Bowtie 2 does not guarantee that the alignment reported is the best possible in terms of alignment score.</p>
 <p>See also: <a href="#bowtie2-options-D"><code>-D</code></a>, which puts an upper limit on the number of dynamic programming problems (i.e. seed extensions) that can &quot;fail&quot; in a row before Bowtie 2 stops searching. Increasing <a href="#bowtie2-options-D"><code>-D</code></a> makes Bowtie 2 slower, but increases the likelihood that it will report the correct alignment for a read that aligns many places.</p>
 <p>See also: <a href="#bowtie2-options-R"><code>-R</code></a>, which sets the maximum number of times Bowtie 2 will &quot;re-seed&quot; when attempting to align a read with repetitive seeds. Increasing <a href="#bowtie2-options-R"><code>-R</code></a> makes Bowtie 2 slower, but increases the likelihood that it will report the correct alignment for a read that aligns many places.</p>
 <h3 id="k-mode-search-for-one-or-more-alignments-report-each">-k mode: search for one or more alignments, report each</h3>
@@ -249,7 +249,7 @@ <h2 id="presets-setting-many-settings-at-once">Presets: setting many settings at
 <h2 id="filtering">Filtering</h2>
 <p>Some reads are skipped or &quot;filtered out&quot; by Bowtie 2. For example, reads may be filtered out because they are extremely short or have a high proportion of ambiguous nucleotides. Bowtie 2 will still print a SAM record for such a read, but no alignment will be reported and and the <code>YF:i</code> SAM optional field will be set to indicate the reason the read was filtered.</p>
 <ul>
-<li><code>YF:Z:LN</code>: the read was filtered becuase it had length less than or equal to the number of seed mismatches set with the <a href="#bowtie2-options-N"><code>-N</code></a> option.</li>
+<li><code>YF:Z:LN</code>: the read was filtered because it had length less than or equal to the number of seed mismatches set with the <a href="#bowtie2-options-N"><code>-N</code></a> option.</li>
 <li><code>YF:Z:NS</code>: the read was filtered because it contains a number of ambiguous characters (usually <code>N</code> or <code>.</code>) greater than the ceiling specified with <a href="#bowtie2-options-n-ceil"><code>--n-ceil</code></a>.</li>
 <li><code>YF:Z:SC</code>: the read was filtered because the read length and the match bonus (set with <a href="#bowtie2-options-ma"><code>--ma</code></a>) are such that the read can't possibly earn an alignment score greater than or equal to the threshold set with <a href="#bowtie2-options-score-min"><code>--score-min</code></a></li>
 <li><code>YF:Z:QC</code>: the read was filtered because it was marked as failing quality control and the user specified the <a href="#bowtie2-options-qc-filter"><code>--qc-filter</code></a> option. This only happens when the input is in Illumina's QSEQ format (i.e. when <a href="#bowtie2-options-qseq"><code>--qseq</code></a> is specified) and the last (11th) field of the read's QSEQ record contains <code>1</code>.</li>
@@ -510,14 +510,14 @@ <h4 id="alignment-options">Alignment options</h4>
 <pre><code>-L &lt;int&gt;</code></pre>
 </td><td>
 
-<p>Sets the length of the seed substrings to align during <a href="#multiseed-heuristic">multiseed alignment</a>. Smaller values make alignment slower but more senstive. Default: the <a href="#bowtie2-options-sensitive"><code>--sensitive</code></a> preset is used by default, which sets <code>-L</code> to 20 both in <a href="#bowtie2-options-end-to-end"><code>--end-to-end</code></a> mode and in <a href="#bowtie2-options-local"><code>--local</code></a> mode.</p>
+<p>Sets the length of the seed substrings to align during <a href="#multiseed-heuristic">multiseed alignment</a>. Smaller values make alignment slower but more sensitive. Default: the <a href="#bowtie2-options-sensitive"><code>--sensitive</code></a> preset is used by default, which sets <code>-L</code> to 20 both in <a href="#bowtie2-options-end-to-end"><code>--end-to-end</code></a> mode and in <a href="#bowtie2-options-local"><code>--local</code></a> mode.</p>
 </td></tr>
 <tr><td id="bowtie2-options-i">
 
 <pre><code>-i &lt;func&gt;</code></pre>
 </td><td>
 
-<p>Sets a function governing the interval between seed substrings to use during <a href="#multiseed-heuristic">multiseed alignment</a>. For instance, if the read has 30 characers, and seed length is 10, and the seed interval is 6, the seeds extracted will be:</p>
+<p>Sets a function governing the interval between seed substrings to use during <a href="#multiseed-heuristic">multiseed alignment</a>. For instance, if the read has 30 characters, and seed length is 10, and the seed interval is 6, the seeds extracted will be:</p>
 <pre><code>Read:      TAGCTACGCTCTACGCTATCATGCATAAAC
 Seed 1 fw: TAGCTACGCT
 Seed 1 rc: AGCGTAGCTA
@@ -940,7 +940,7 @@ <h4 id="other-options">Other options</h4>
 <h2 id="sam-output">SAM output</h2>
 <p>Following is a brief description of the <a href="http://samtools.sourceforge.net/SAM1.pdf">SAM</a> format as output by <code>bowtie2</code>. For more details, see the <a href="http://samtools.sourceforge.net/SAM1.pdf">SAM format specification</a>.</p>
 <p>By default, <code>bowtie2</code> prints a SAM header with <code>@HD</code>, <code>@SQ</code> and <code>@PG</code> lines. When one or more <a href="#bowtie2-options-rg"><code>--rg</code></a> arguments are specified, <code>bowtie2</code> will also print an <code>@RG</code> line that includes all user-specified <a href="#bowtie2-options-rg"><code>--rg</code></a> tokens separated by tabs.</p>
-<p>Each subsequnt line describes an alignment or, if the read failed to align, a read. Each line is a collection of at least 12 fields separated by tabs; from left to right, the fields are:</p>
+<p>Each subsequent line describes an alignment or, if the read failed to align, a read. Each line is a collection of at least 12 fields separated by tabs; from left to right, the fields are:</p>
 <ol style="list-style-type: decimal">
 <li><p>Name of read that aligned.</p>
 <p>Note that the <a href="http://samtools.sourceforge.net/SAM1.pdf">SAM specification</a> disallows whitespace in the read name. If the read name contains any whitespace characters, Bowtie 2 will truncate the name at the first whitespace character. This is similar to the behavior of other tools.</p></li>
@@ -1210,6 +1210,12 @@ <h3 id="options-1">Options</h3>
 <p><code>bowtie2-build</code> is verbose by default. With this option <code>bowtie2-build</code> will print only error messages.</p>
 </td></tr><tr><td>
 
+<pre><code>--threads &lt;int&gt;</code></pre>
+</td><td>
+
+<p>By default <code>bowtie2-build</code> is using only one thread. Increasing the number of threads will speed up the index building considerably in most cases.</p>
+</td></tr><tr><td>
+
 <pre><code>-h/--help</code></pre>
 </td><td>