| Process Name | \\n\\", + " \\ Software | \\nVersion | \\n
|---|---|---|
| CUSTOM_DUMPSOFTWAREVERSIONS | \\npython | \\n\\", + " \\3.11.7 | \\n
| \\n \\", + " \\ | yaml | \\n5.4.1 | \\n
| TOOL1 | \\ntool1 | \\n\\", + " \\0.11.9 | \\n
| TOOL2 | \\n\\", + " \\tool2 | \\n1.9 | \\n
| Workflow | \\nNextflow | \\n\\" + ], + [ + "CUSTOM_DUMPSOFTWAREVERSIONS:", + " python: 3.11.7", + " yaml: 5.4.1", + "TOOL1:", + " tool1: 0.11.9", + "TOOL2:", + " tool2: '1.9'", + "Workflow:" + ] + ], + "timestamp": "2024-01-09T23:01:18.710682" + } +} \ No newline at end of file diff --git a/modules/nf-core/custom/dumpsoftwareversions/tests/tags.yml b/modules/nf-core/custom/dumpsoftwareversions/tests/tags.yml new file mode 100644 index 0000000..405aa24 --- /dev/null +++ b/modules/nf-core/custom/dumpsoftwareversions/tests/tags.yml @@ -0,0 +1,2 @@ +custom/dumpsoftwareversions: + - modules/nf-core/custom/dumpsoftwareversions/** diff --git a/modules/nf-core/deepvariant/environment.yml b/modules/nf-core/deepvariant/environment.yml deleted file mode 100644 index bcd3a8b..0000000 --- a/modules/nf-core/deepvariant/environment.yml +++ /dev/null @@ -1,4 +0,0 @@ -channels: - - conda-forge - - bioconda - - defaults diff --git a/modules/nf-core/deepvariant/meta.yml b/modules/nf-core/deepvariant/meta.yml deleted file mode 100644 index a50dc57..0000000 --- a/modules/nf-core/deepvariant/meta.yml +++ /dev/null @@ -1,83 +0,0 @@ -name: deepvariant -description: DeepVariant is an analysis pipeline that uses a deep neural network to call genetic variants from next-generation DNA sequencing data -keywords: - - variant calling - - machine learning - - neural network -tools: - - deepvariant: - description: DeepVariant is an analysis pipeline that uses a deep neural network to call genetic variants from next-generation DNA sequencing data - homepage: https://github.com/google/deepvariant - documentation: https://github.com/google/deepvariant - tool_dev_url: https://github.com/google/deepvariant - doi: "10.1038/nbt.4235" - licence: ["BSD-3-clause"] -input: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - input: - type: file - description: BAM/CRAM file - pattern: "*.bam/cram" - - index: - type: file - description: Index of BAM/CRAM file - pattern: "*.bai/crai" - - interval: - type: file - description: Interval file for targeted regions - pattern: "*.bed" - - meta2: - type: map - description: | - Groovy Map containing reference information - e.g. [ id:'genome' ] - - fasta: - type: file - description: The reference fasta file - pattern: "*.fasta" - - meta3: - type: map - description: | - Groovy Map containing reference information - e.g. [ id:'genome' ] - - fai: - type: file - description: Index of reference fasta file - pattern: "*.fai" - - meta4: - type: map - description: | - Groovy Map containing reference information - e.g. [ id:'genome' ] - - gzi: - type: file - description: GZI index of reference fasta file - pattern: "*.gzi" -output: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - vcf: - type: file - description: Compressed VCF file - pattern: "*.vcf.gz" - - gvcf: - type: file - description: Compressed GVCF file - pattern: "*.g.vcf.gz" - - version: - type: file - description: File containing software version - pattern: "*.{version.txt}" -authors: - - "@abhi18av" - - "@ramprasadn" -maintainers: - - "@abhi18av" - - "@ramprasadn" diff --git a/modules/nf-core/deepvariant/main.nf b/modules/nf-core/deepvariant/rundeepvariant/main.nf similarity index 71% rename from modules/nf-core/deepvariant/main.nf rename to modules/nf-core/deepvariant/rundeepvariant/main.nf index 2d5c480..7f99c53 100644 --- a/modules/nf-core/deepvariant/main.nf +++ b/modules/nf-core/deepvariant/rundeepvariant/main.nf @@ -1,14 +1,18 @@ -process DEEPVARIANT { +process DEEPVARIANT_RUNDEEPVARIANT { tag "$meta.id" label 'process_high' - container "nf-core/deepvariant:1.5.0" + // FIXME Conda is not supported at the moment + // BUG https://github.com/nf-core/modules/issues/1754 + // BUG https://github.com/bioconda/bioconda-recipes/issues/30310 + container "nf-core/deepvariant:1.6.1" input: tuple val(meta), path(input), path(index), path(intervals) tuple val(meta2), path(fasta) tuple val(meta3), path(fai) tuple val(meta4), path(gzi) + tuple val(meta5), path(par_bed) output: tuple val(meta), path("${prefix}.vcf.gz") , emit: vcf @@ -28,6 +32,10 @@ process DEEPVARIANT { def args = task.ext.args ?: '' prefix = task.ext.prefix ?: "${meta.id}" def regions = intervals ? "--regions=${intervals}" : "" + def par_regions = par_bed ? "--par_regions_bed=${par_bed}" : "" + // WARN https://github.com/nf-core/modules/pull/5801#issuecomment-2194293755 + // FIXME Revert this on next version bump + def VERSION = '1.6.1' """ /opt/deepvariant/bin/run_deepvariant \\ @@ -37,12 +45,13 @@ process DEEPVARIANT { --output_gvcf=${prefix}.g.vcf.gz \\ ${args} \\ ${regions} \\ - --intermediate_results_dir=. \\ + ${par_regions} \\ + --intermediate_results_dir=tmp \\ --num_shards=${task.cpus} cat <<-END_VERSIONS > versions.yml "${task.process}": - deepvariant: \$(echo \$(/opt/deepvariant/bin/run_deepvariant --version) | sed 's/^.*version //; s/ .*\$//' ) + deepvariant: $VERSION END_VERSIONS """ @@ -52,6 +61,9 @@ process DEEPVARIANT { error "DEEPVARIANT module does not support Conda. Please use Docker / Singularity / Podman instead." } prefix = task.ext.prefix ?: "${meta.id}" + // WARN https://github.com/nf-core/modules/pull/5801#issuecomment-2194293755 + // FIXME Revert this on next version bump + def VERSION = '1.6.1' """ touch ${prefix}.vcf.gz touch ${prefix}.vcf.gz.tbi @@ -60,7 +72,7 @@ process DEEPVARIANT { cat <<-END_VERSIONS > versions.yml "${task.process}": - deepvariant: \$(echo \$(/opt/deepvariant/bin/run_deepvariant --version) | sed 's/^.*version //; s/ .*\$//' ) + deepvariant: $VERSION END_VERSIONS """ } diff --git a/modules/nf-core/deepvariant/rundeepvariant/meta.yml b/modules/nf-core/deepvariant/rundeepvariant/meta.yml new file mode 100644 index 0000000..29b45ff --- /dev/null +++ b/modules/nf-core/deepvariant/rundeepvariant/meta.yml @@ -0,0 +1,122 @@ +name: deepvariant_rundeepvariant +description: DeepVariant is an analysis pipeline that uses a deep neural network to + call genetic variants from next-generation DNA sequencing data +keywords: + - variant calling + - machine learning + - neural network +tools: + - deepvariant: + description: DeepVariant is an analysis pipeline that uses a deep neural network + to call genetic variants from next-generation DNA sequencing data + homepage: https://github.com/google/deepvariant + documentation: https://github.com/google/deepvariant + tool_dev_url: https://github.com/google/deepvariant + doi: "10.1038/nbt.4235" + licence: ["BSD-3-clause"] + identifier: biotools:deepvariant +input: + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - input: + type: file + description: BAM/CRAM file + pattern: "*.bam/cram" + - index: + type: file + description: Index of BAM/CRAM file + pattern: "*.bai/crai" + - intervals: + type: file + description: file containing intervals + - - meta2: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'genome' ] + - fasta: + type: file + description: The reference fasta file + pattern: "*.fasta" + - - meta3: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'genome' ] + - fai: + type: file + description: Index of reference fasta file + pattern: "*.fai" + - - meta4: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'genome' ] + - gzi: + type: file + description: GZI index of reference fasta file + pattern: "*.gzi" + - - meta5: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'genome' ] + - par_bed: + type: file + description: BED file containing PAR regions + pattern: "*.bed" +output: + - vcf: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - ${prefix}.vcf.gz: + type: file + description: Compressed VCF file + pattern: "*.vcf.gz" + - vcf_tbi: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - ${prefix}.vcf.gz.tbi: + type: file + description: Tabix index file of compressed VCF + pattern: "*.vcf.gz.tbi" + - gvcf: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - ${prefix}.g.vcf.gz: + type: file + description: Compressed GVCF file + pattern: "*.g.vcf.gz" + - gvcf_tbi: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - ${prefix}.g.vcf.gz.tbi: + type: file + description: Tabix index file of compressed GVCF + pattern: "*.g.vcf.gz.tbi" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" +authors: + - "@abhi18av" + - "@ramprasadn" +maintainers: + - "@abhi18av" + - "@ramprasadn" diff --git a/modules/nf-core/deepvariant/rundeepvariant/tests/main.nf.test b/modules/nf-core/deepvariant/rundeepvariant/tests/main.nf.test new file mode 100644 index 0000000..0790fb8 --- /dev/null +++ b/modules/nf-core/deepvariant/rundeepvariant/tests/main.nf.test @@ -0,0 +1,166 @@ +nextflow_process { + + name "Test Process DEEPVARIANT_RUNDEEPVARIANT" + script "../main.nf" + process "DEEPVARIANT_RUNDEEPVARIANT" + + tag "deepvariant/rundeepvariant" + tag "deepvariant" + tag "modules" + tag "modules_nfcore" + + test("homo_sapiens - [bam, bai] - fasta - fai") { + when { + config "./nextflow.config" + + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + '/genomics/homo_sapiens/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), + file(params.modules_testdata_base_path + '/genomics/homo_sapiens/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true), + [] + ] + input[1] = [ + [ id:'genome'], + file(params.modules_testdata_base_path + '/genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) + ] + input[2] = [ + [ id:'genome'], + file(params.modules_testdata_base_path + '/genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) + ] + input[3] = [ + [],[] + ] + input[4] = [ + [],[] + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("homo_sapiens - [cram, crai, genome_bed] - fasta - fai") { + config "./nextflow-intervals.config" + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + '/genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true), + file(params.modules_testdata_base_path + '/genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram.crai', checkIfExists: true), + file(params.modules_testdata_base_path + '/genomics/homo_sapiens/genome/genome.bed', checkIfExists: true) + ] + input[1] = [ + [ id:'genome'], + file(params.modules_testdata_base_path + '/genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) + ] + input[2] = [ + [ id:'genome'], + file(params.modules_testdata_base_path + '/genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) + ] + input[3] = [ + [],[] + ] + input[4] = [ + [],[] + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("homo_sapiens - [cram, crai, genome_bed] - fasta - fai - par_bed") { + config "./nextflow-non-autosomal-calling.config" + tag "test" + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + '/genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true), + file(params.modules_testdata_base_path + '/genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram.crai', checkIfExists: true), + file(params.modules_testdata_base_path + '/genomics/homo_sapiens/genome/genome.bed', checkIfExists: true) + ] + input[1] = [ + [ id:'genome'], + file(params.modules_testdata_base_path + '/genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) + ] + input[2] = [ + [ id:'genome'], + file(params.modules_testdata_base_path + '/genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) + ] + input[3] = [ + [],[] + ] + input[4] = [ + [ id:'genome'], + file(params.modules_testdata_base_path + '/genomics/homo_sapiens/genome/genome.blacklist_intervals.bed', checkIfExists: true) + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("homo_sapiens - [bam, bai] - fasta_gz - fasta_gz_fai") { + when { + config "./nextflow.config" + + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + '/genomics/homo_sapiens/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), + file(params.modules_testdata_base_path + '/genomics/homo_sapiens/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true), + [] + ] + input[1] = [ + [ id:'genome'], + file(params.modules_testdata_base_path + '/genomics/homo_sapiens/genome/genome.fasta.gz', checkIfExists: true) + ] + input[2] = [ + [ id:'genome'], + file(params.modules_testdata_base_path + '/genomics/homo_sapiens/genome/genome.fasta.gz.fai', checkIfExists: true) + ] + input[3] = [ + [ id:'genome'], + file(params.modules_testdata_base_path + '/genomics/homo_sapiens/genome/genome.fasta.gz.gzi', checkIfExists: true) + ] + input[4] = [ + [],[] + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + +} diff --git a/modules/nf-core/deepvariant/rundeepvariant/tests/main.nf.test.snap b/modules/nf-core/deepvariant/rundeepvariant/tests/main.nf.test.snap new file mode 100644 index 0000000..1ec351e --- /dev/null +++ b/modules/nf-core/deepvariant/rundeepvariant/tests/main.nf.test.snap @@ -0,0 +1,358 @@ +{ + "homo_sapiens - [bam, bai] - fasta_gz - fasta_gz_fai": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test_out.vcf.gz:md5,8b8ab4a675f01e437aa72e1438a717d0" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test_out.vcf.gz.tbi:md5,0000833138104e87b05eaa906821eb21" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test_out.g.vcf.gz:md5,0a629e1745926cfcedf4b169046a921a" + ] + ], + "3": [ + [ + { + "id": "test", + "single_end": false + }, + "test_out.g.vcf.gz.tbi:md5,49503913c28ec70a6f4aa52f6b357b4d" + ] + ], + "4": [ + "versions.yml:md5,a251d8d9f5e8b737d8298eead96c0890" + ], + "gvcf": [ + [ + { + "id": "test", + "single_end": false + }, + "test_out.g.vcf.gz:md5,0a629e1745926cfcedf4b169046a921a" + ] + ], + "gvcf_tbi": [ + [ + { + "id": "test", + "single_end": false + }, + "test_out.g.vcf.gz.tbi:md5,49503913c28ec70a6f4aa52f6b357b4d" + ] + ], + "vcf": [ + [ + { + "id": "test", + "single_end": false + }, + "test_out.vcf.gz:md5,8b8ab4a675f01e437aa72e1438a717d0" + ] + ], + "vcf_tbi": [ + [ + { + "id": "test", + "single_end": false + }, + "test_out.vcf.gz.tbi:md5,0000833138104e87b05eaa906821eb21" + ] + ], + "versions": [ + "versions.yml:md5,a251d8d9f5e8b737d8298eead96c0890" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-08-29T11:36:27.325363" + }, + "homo_sapiens - [bam, bai] - fasta - fai": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test_out.vcf.gz:md5,8b8ab4a675f01e437aa72e1438a717d0" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test_out.vcf.gz.tbi:md5,0000833138104e87b05eaa906821eb21" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test_out.g.vcf.gz:md5,0a629e1745926cfcedf4b169046a921a" + ] + ], + "3": [ + [ + { + "id": "test", + "single_end": false + }, + "test_out.g.vcf.gz.tbi:md5,49503913c28ec70a6f4aa52f6b357b4d" + ] + ], + "4": [ + "versions.yml:md5,a251d8d9f5e8b737d8298eead96c0890" + ], + "gvcf": [ + [ + { + "id": "test", + "single_end": false + }, + "test_out.g.vcf.gz:md5,0a629e1745926cfcedf4b169046a921a" + ] + ], + "gvcf_tbi": [ + [ + { + "id": "test", + "single_end": false + }, + "test_out.g.vcf.gz.tbi:md5,49503913c28ec70a6f4aa52f6b357b4d" + ] + ], + "vcf": [ + [ + { + "id": "test", + "single_end": false + }, + "test_out.vcf.gz:md5,8b8ab4a675f01e437aa72e1438a717d0" + ] + ], + "vcf_tbi": [ + [ + { + "id": "test", + "single_end": false + }, + "test_out.vcf.gz.tbi:md5,0000833138104e87b05eaa906821eb21" + ] + ], + "versions": [ + "versions.yml:md5,a251d8d9f5e8b737d8298eead96c0890" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-08-29T11:34:41.779153" + }, + "homo_sapiens - [cram, crai, genome_bed] - fasta - fai": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test_out.vcf.gz:md5,8b8ab4a675f01e437aa72e1438a717d0" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test_out.vcf.gz.tbi:md5,0000833138104e87b05eaa906821eb21" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test_out.g.vcf.gz:md5,0a629e1745926cfcedf4b169046a921a" + ] + ], + "3": [ + [ + { + "id": "test", + "single_end": false + }, + "test_out.g.vcf.gz.tbi:md5,49503913c28ec70a6f4aa52f6b357b4d" + ] + ], + "4": [ + "versions.yml:md5,a251d8d9f5e8b737d8298eead96c0890" + ], + "gvcf": [ + [ + { + "id": "test", + "single_end": false + }, + "test_out.g.vcf.gz:md5,0a629e1745926cfcedf4b169046a921a" + ] + ], + "gvcf_tbi": [ + [ + { + "id": "test", + "single_end": false + }, + "test_out.g.vcf.gz.tbi:md5,49503913c28ec70a6f4aa52f6b357b4d" + ] + ], + "vcf": [ + [ + { + "id": "test", + "single_end": false + }, + "test_out.vcf.gz:md5,8b8ab4a675f01e437aa72e1438a717d0" + ] + ], + "vcf_tbi": [ + [ + { + "id": "test", + "single_end": false + }, + "test_out.vcf.gz.tbi:md5,0000833138104e87b05eaa906821eb21" + ] + ], + "versions": [ + "versions.yml:md5,a251d8d9f5e8b737d8298eead96c0890" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-08-29T11:35:16.993129" + }, + "homo_sapiens - [cram, crai, genome_bed] - fasta - fai - par_bed": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test_out.vcf.gz:md5,d2e26d65dbbcea9b087ed191b5c9841c" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test_out.vcf.gz.tbi:md5,0801296d0356415bbf1ef8deb4ec84c3" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test_out.g.vcf.gz:md5,4fcaa9a8b55730d191382160c2b5bb0a" + ] + ], + "3": [ + [ + { + "id": "test", + "single_end": false + }, + "test_out.g.vcf.gz.tbi:md5,f468e846904733b3231ecf00ef7cd4a2" + ] + ], + "4": [ + "versions.yml:md5,a251d8d9f5e8b737d8298eead96c0890" + ], + "gvcf": [ + [ + { + "id": "test", + "single_end": false + }, + "test_out.g.vcf.gz:md5,4fcaa9a8b55730d191382160c2b5bb0a" + ] + ], + "gvcf_tbi": [ + [ + { + "id": "test", + "single_end": false + }, + "test_out.g.vcf.gz.tbi:md5,f468e846904733b3231ecf00ef7cd4a2" + ] + ], + "vcf": [ + [ + { + "id": "test", + "single_end": false + }, + "test_out.vcf.gz:md5,d2e26d65dbbcea9b087ed191b5c9841c" + ] + ], + "vcf_tbi": [ + [ + { + "id": "test", + "single_end": false + }, + "test_out.vcf.gz.tbi:md5,0801296d0356415bbf1ef8deb4ec84c3" + ] + ], + "versions": [ + "versions.yml:md5,a251d8d9f5e8b737d8298eead96c0890" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-08-29T11:35:52.23093" + } +} \ No newline at end of file diff --git a/modules/nf-core/deepvariant/rundeepvariant/tests/nextflow-intervals.config b/modules/nf-core/deepvariant/rundeepvariant/tests/nextflow-intervals.config new file mode 100644 index 0000000..78d8d59 --- /dev/null +++ b/modules/nf-core/deepvariant/rundeepvariant/tests/nextflow-intervals.config @@ -0,0 +1,8 @@ +process { + + withName: DEEPVARIANT_RUNDEEPVARIANT { + ext.args = '--model_type=WGS ' + ext.prefix = { "${meta.id}_out" } + } + +} diff --git a/modules/nf-core/deepvariant/rundeepvariant/tests/nextflow-non-autosomal-calling.config b/modules/nf-core/deepvariant/rundeepvariant/tests/nextflow-non-autosomal-calling.config new file mode 100644 index 0000000..6d26529 --- /dev/null +++ b/modules/nf-core/deepvariant/rundeepvariant/tests/nextflow-non-autosomal-calling.config @@ -0,0 +1,8 @@ +process { + + withName: DEEPVARIANT_RUNDEEPVARIANT { + ext.args = '--model_type=WGS --haploid_contigs chr22' + ext.prefix = { "${meta.id}_out" } + } + +} diff --git a/modules/nf-core/deepvariant/rundeepvariant/tests/nextflow.config b/modules/nf-core/deepvariant/rundeepvariant/tests/nextflow.config new file mode 100644 index 0000000..77e355c --- /dev/null +++ b/modules/nf-core/deepvariant/rundeepvariant/tests/nextflow.config @@ -0,0 +1,8 @@ +process { + + withName: DEEPVARIANT_RUNDEEPVARIANT { + ext.args = ' --regions=\"chr22:0-40001\" --model_type=WGS ' + ext.prefix = { "${meta.id}_out" } + } + +} diff --git a/modules/nf-core/deepvariant/rundeepvariant/tests/tags.yml b/modules/nf-core/deepvariant/rundeepvariant/tests/tags.yml new file mode 100644 index 0000000..958b8e4 --- /dev/null +++ b/modules/nf-core/deepvariant/rundeepvariant/tests/tags.yml @@ -0,0 +1,2 @@ +deepvariant/rundeepvariant: + - modules/nf-core/deepvariant/rundeepvariant/** diff --git a/modules/nf-core/gunzip/environment.yml b/modules/nf-core/gunzip/environment.yml index 25910b3..c779485 100644 --- a/modules/nf-core/gunzip/environment.yml +++ b/modules/nf-core/gunzip/environment.yml @@ -1,7 +1,7 @@ -name: gunzip channels: - conda-forge - bioconda - - defaults dependencies: - - conda-forge::sed=4.7 + - conda-forge::grep=3.11 + - conda-forge::sed=4.8 + - conda-forge::tar=1.34 diff --git a/modules/nf-core/gunzip/main.nf b/modules/nf-core/gunzip/main.nf index 468a6f2..5e67e3b 100644 --- a/modules/nf-core/gunzip/main.nf +++ b/modules/nf-core/gunzip/main.nf @@ -4,8 +4,8 @@ process GUNZIP { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/ubuntu:20.04' : - 'nf-core/ubuntu:20.04' }" + 'https://depot.galaxyproject.org/singularity/ubuntu:22.04' : + 'nf-core/ubuntu:22.04' }" input: tuple val(meta), path(archive) @@ -18,8 +18,11 @@ process GUNZIP { task.ext.when == null || task.ext.when script: - def args = task.ext.args ?: '' - gunzip = archive.toString() - '.gz' + def args = task.ext.args ?: '' + def extension = ( archive.toString() - '.gz' ).tokenize('.')[-1] + def name = archive.toString() - '.gz' - ".$extension" + def prefix = task.ext.prefix ?: name + gunzip = prefix + ".$extension" """ # Not calling gunzip itself because it creates files # with the original group ownership rather than the @@ -37,7 +40,11 @@ process GUNZIP { """ stub: - gunzip = archive.toString() - '.gz' + def args = task.ext.args ?: '' + def extension = ( archive.toString() - '.gz' ).tokenize('.')[-1] + def name = archive.toString() - '.gz' - ".$extension" + def prefix = task.ext.prefix ?: name + gunzip = prefix + ".$extension" """ touch $gunzip cat <<-END_VERSIONS > versions.yml diff --git a/modules/nf-core/gunzip/meta.yml b/modules/nf-core/gunzip/meta.yml index 231034f..9066c03 100644 --- a/modules/nf-core/gunzip/meta.yml +++ b/modules/nf-core/gunzip/meta.yml @@ -10,25 +10,32 @@ tools: gzip is a file format and a software application used for file compression and decompression. documentation: https://www.gnu.org/software/gzip/manual/gzip.html licence: ["GPL-3.0-or-later"] + identifier: "" input: - - meta: - type: map - description: | - Optional groovy Map containing meta information - e.g. [ id:'test', single_end:false ] - - archive: - type: file - description: File to be compressed/uncompressed - pattern: "*.*" + - - meta: + type: map + description: | + Optional groovy Map containing meta information + e.g. [ id:'test', single_end:false ] + - archive: + type: file + description: File to be compressed/uncompressed + pattern: "*.*" output: - gunzip: - type: file - description: Compressed/uncompressed file - pattern: "*.*" + - meta: + type: file + description: Compressed/uncompressed file + pattern: "*.*" + - $gunzip: + type: file + description: Compressed/uncompressed file + pattern: "*.*" - versions: - type: file - description: File containing software versions - pattern: "versions.yml" + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@joseespinosa" - "@drpatelh" @@ -37,3 +44,4 @@ maintainers: - "@joseespinosa" - "@drpatelh" - "@jfy133" + - "@gallvp" diff --git a/modules/nf-core/gunzip/tests/main.nf.test b/modules/nf-core/gunzip/tests/main.nf.test index d031792..776211a 100644 --- a/modules/nf-core/gunzip/tests/main.nf.test +++ b/modules/nf-core/gunzip/tests/main.nf.test @@ -15,10 +15,96 @@ nextflow_process { } process { """ - input[0] = [ - [], - file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) - ] + input[0] = Channel.of([ + [], + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ] + ) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("Should run without failures - prefix") { + + config './nextflow.config' + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = Channel.of([ + [ id: 'test' ], + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ] + ) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("Should run without failures - stub") { + + options '-stub' + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = Channel.of([ + [], + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ] + ) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("Should run without failures - prefix - stub") { + + options '-stub' + config './nextflow.config' + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = Channel.of([ + [ id: 'test' ], + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ] + ) """ } } diff --git a/modules/nf-core/gunzip/tests/main.nf.test.snap b/modules/nf-core/gunzip/tests/main.nf.test.snap index 720fd9f..069967e 100644 --- a/modules/nf-core/gunzip/tests/main.nf.test.snap +++ b/modules/nf-core/gunzip/tests/main.nf.test.snap @@ -1,4 +1,70 @@ { + "Should run without failures - prefix - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.xyz.fastq:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,54376d32aca20e937a4ec26dac228e84" + ], + "gunzip": [ + [ + { + "id": "test" + }, + "test.xyz.fastq:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,54376d32aca20e937a4ec26dac228e84" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-25T11:35:10.861293" + }, + "Should run without failures - stub": { + "content": [ + { + "0": [ + [ + [ + + ], + "test_1.fastq:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,54376d32aca20e937a4ec26dac228e84" + ], + "gunzip": [ + [ + [ + + ], + "test_1.fastq:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,54376d32aca20e937a4ec26dac228e84" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-25T11:35:05.857145" + }, "Should run without failures": { "content": [ { @@ -26,6 +92,43 @@ ] } ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, "timestamp": "2023-10-17T15:35:37.690477896" + }, + "Should run without failures - prefix": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.xyz.fastq:md5,4161df271f9bfcd25d5845a1e220dbec" + ] + ], + "1": [ + "versions.yml:md5,54376d32aca20e937a4ec26dac228e84" + ], + "gunzip": [ + [ + { + "id": "test" + }, + "test.xyz.fastq:md5,4161df271f9bfcd25d5845a1e220dbec" + ] + ], + "versions": [ + "versions.yml:md5,54376d32aca20e937a4ec26dac228e84" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-25T11:33:32.921739" } } \ No newline at end of file diff --git a/modules/nf-core/gunzip/tests/nextflow.config b/modules/nf-core/gunzip/tests/nextflow.config new file mode 100644 index 0000000..dec7764 --- /dev/null +++ b/modules/nf-core/gunzip/tests/nextflow.config @@ -0,0 +1,5 @@ +process { + withName: GUNZIP { + ext.prefix = { "${meta.id}.xyz" } + } +} diff --git a/modules/nf-core/minimap2/align/environment.yml b/modules/nf-core/minimap2/align/environment.yml index 60b9a8b..dc6476b 100644 --- a/modules/nf-core/minimap2/align/environment.yml +++ b/modules/nf-core/minimap2/align/environment.yml @@ -1,8 +1,8 @@ -name: minimap2_align channels: - conda-forge - bioconda - - defaults + dependencies: - - bioconda::minimap2=2.24 - - bioconda::samtools=1.14 + - bioconda::htslib=1.20 + - bioconda::minimap2=2.28 + - bioconda::samtools=1.20 diff --git a/modules/nf-core/minimap2/align/main.nf b/modules/nf-core/minimap2/align/main.nf index fa3ae50..d82dc14 100644 --- a/modules/nf-core/minimap2/align/main.nf +++ b/modules/nf-core/minimap2/align/main.nf @@ -1,45 +1,75 @@ process MINIMAP2_ALIGN { tag "$meta.id" - label 'process_medium' + label 'process_high' // Note: the versions here need to match the versions used in the mulled container below and minimap2/index conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/mulled-v2-66534bcbb7031a148b13e2ad42583020b9cd25c4:1679e915ddb9d6b4abda91880c4b48857d471bd8-0' : - 'biocontainers/mulled-v2-66534bcbb7031a148b13e2ad42583020b9cd25c4:1679e915ddb9d6b4abda91880c4b48857d471bd8-0' }" + 'https://depot.galaxyproject.org/singularity/mulled-v2-66534bcbb7031a148b13e2ad42583020b9cd25c4:3161f532a5ea6f1dec9be5667c9efc2afdac6104-0' : + 'biocontainers/mulled-v2-66534bcbb7031a148b13e2ad42583020b9cd25c4:3161f532a5ea6f1dec9be5667c9efc2afdac6104-0' }" input: tuple val(meta), path(reads) tuple val(meta2), path(reference) val bam_format + val bam_index_extension val cigar_paf_format val cigar_bam output: - tuple val(meta), path("*.paf"), optional: true, emit: paf - tuple val(meta), path("*.bam"), optional: true, emit: bam - path "versions.yml" , emit: versions + tuple val(meta), path("*.paf") , optional: true, emit: paf + tuple val(meta), path("*.bam") , optional: true, emit: bam + tuple val(meta), path("*.bam.${bam_index_extension}"), optional: true, emit: index + path "versions.yml" , emit: versions when: task.ext.when == null || task.ext.when script: - def args = task.ext.args ?: '' + def args = task.ext.args ?: '' + def args2 = task.ext.args2 ?: '' + def args3 = task.ext.args3 ?: '' + def args4 = task.ext.args4 ?: '' def prefix = task.ext.prefix ?: "${meta.id}" - def bam_output = bam_format ? "-a | samtools sort | samtools view -@ ${task.cpus} -b -h -o ${prefix}.bam" : "-o ${prefix}.paf" + def bam_index = bam_index_extension ? "${prefix}.bam##idx##${prefix}.bam.${bam_index_extension} --write-index" : "${prefix}.bam" + def bam_output = bam_format ? "-a | samtools sort -@ ${task.cpus-1} -o ${bam_index} ${args2}" : "-o ${prefix}.paf" def cigar_paf = cigar_paf_format && !bam_format ? "-c" : '' def set_cigar_bam = cigar_bam && bam_format ? "-L" : '' + def bam_input = "${reads.extension}".matches('sam|bam|cram') + def samtools_reset_fastq = bam_input ? "samtools reset --threads ${task.cpus-1} $args3 $reads | samtools fastq --threads ${task.cpus-1} $args4 |" : '' + def query = bam_input ? "-" : reads + def target = reference ?: (bam_input ? error("BAM input requires reference") : reads) + """ + $samtools_reset_fastq \\ minimap2 \\ $args \\ -t $task.cpus \\ - "${reference ?: reads}" \\ - "$reads" \\ + $target \\ + $query \\ $cigar_paf \\ $set_cigar_bam \\ $bam_output + cat <<-END_VERSIONS > versions.yml + "${task.process}": + minimap2: \$(minimap2 --version 2>&1) + samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//') + END_VERSIONS + """ + + stub: + def prefix = task.ext.prefix ?: "${meta.id}" + def output_file = bam_format ? "${prefix}.bam" : "${prefix}.paf" + def bam_index = bam_index_extension ? "touch ${prefix}.bam.${bam_index_extension}" : "" + def bam_input = "${reads.extension}".matches('sam|bam|cram') + def target = reference ?: (bam_input ? error("BAM input requires reference") : reads) + + """ + touch $output_file + ${bam_index} + cat <<-END_VERSIONS > versions.yml "${task.process}": minimap2: \$(minimap2 --version 2>&1) diff --git a/modules/nf-core/minimap2/align/meta.yml b/modules/nf-core/minimap2/align/meta.yml index 408522d..a4cfc89 100644 --- a/modules/nf-core/minimap2/align/meta.yml +++ b/modules/nf-core/minimap2/align/meta.yml @@ -14,62 +14,86 @@ tools: homepage: https://github.com/lh3/minimap2 documentation: https://github.com/lh3/minimap2#uguide licence: ["MIT"] + identifier: "" input: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - reads: - type: file - description: | - List of input FASTA or FASTQ files of size 1 and 2 for single-end - and paired-end data, respectively. - - meta2: - type: map - description: | - Groovy Map containing reference information - e.g. [ id:'test_ref'] - - reference: - type: file - description: | - Reference database in FASTA format. - - bam_format: - type: boolean - description: Specify that output should be in BAM format - - cigar_paf_format: - type: boolean - description: Specify that output CIGAR should be in PAF format - - cigar_bam: - type: boolean - description: | - Write CIGAR with >65535 ops at the CG tag. This is recommended when - doing XYZ (https://github.com/lh3/minimap2#working-with-65535-cigar-operations) + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - reads: + type: file + description: | + List of input FASTA or FASTQ files of size 1 and 2 for single-end + and paired-end data, respectively. + - - meta2: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'test_ref'] + - reference: + type: file + description: | + Reference database in FASTA format. + - - bam_format: + type: boolean + description: Specify that output should be in BAM format + - - bam_index_extension: + type: string + description: BAM alignment index extension (e.g. "bai") + - - cigar_paf_format: + type: boolean + description: Specify that output CIGAR should be in PAF format + - - cigar_bam: + type: boolean + description: | + Write CIGAR with >65535 ops at the CG tag. This is recommended when + doing XYZ (https://github.com/lh3/minimap2#working-with-65535-cigar-operations) output: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - paf: - type: file - description: Alignment in PAF format - pattern: "*.paf" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.paf": + type: file + description: Alignment in PAF format + pattern: "*.paf" - bam: - type: file - description: Alignment in BAM format - pattern: "*.bam" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.bam": + type: file + description: Alignment in BAM format + pattern: "*.bam" + - index: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.bam.${bam_index_extension}": + type: file + description: BAM alignment index + pattern: "*.bam.*" - versions: - type: file - description: File containing software versions - pattern: "versions.yml" + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@heuermh" - "@sofstam" - "@sateeshperi" - "@jfy133" + - "@fellen31" maintainers: - "@heuermh" - "@sofstam" - "@sateeshperi" - "@jfy133" + - "@fellen31" diff --git a/modules/nf-core/minimap2/align/tests/main.nf.test b/modules/nf-core/minimap2/align/tests/main.nf.test new file mode 100644 index 0000000..4072c17 --- /dev/null +++ b/modules/nf-core/minimap2/align/tests/main.nf.test @@ -0,0 +1,441 @@ +nextflow_process { + + name "Test Process MINIMAP2_ALIGN" + script "../main.nf" + process "MINIMAP2_ALIGN" + + tag "modules" + tag "modules_nfcore" + tag "minimap2" + tag "minimap2/align" + + test("sarscov2 - fastq, fasta, true, [], false, false") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ] + input[1] = [ + [ id:'test_ref' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + input[2] = true + input[3] = [] + input[4] = false + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + bam(process.out.bam[0][1]).getHeader(), + bam(process.out.bam[0][1]).getReadsMD5(), + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - fastq, fasta, true, 'bai', false, false") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ] + input[1] = [ + [ id:'test_ref' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + input[2] = true + input[3] = 'bai' + input[4] = false + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + bam(process.out.bam[0][1]).getHeader(), + bam(process.out.bam[0][1]).getReadsMD5(), + file(process.out.index[0][1]).name, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - [fastq1, fastq2], fasta, true, false, false") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + [ + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) + ] + ] + input[1] = [ + [ id:'test_ref' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + input[2] = true + input[3] = [] + input[4] = false + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + bam(process.out.bam[0][1]).getHeader(), + bam(process.out.bam[0][1]).getReadsMD5(), + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - fastq, [], true, false, false") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + ] + input[1] = [ + [ id:'test_ref' ], // meta map + [] + ] + input[2] = true + input[3] = [] + input[4] = false + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + bam(process.out.bam[0][1]).getHeader(), + bam(process.out.bam[0][1]).getReadsMD5(), + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - bam, fasta, true, [], false, false") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test3.single_end.markduplicates.sorted.bam', checkIfExists: true) + ] + input[1] = [ + [ id:'test_ref' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + input[2] = true + input[3] = [] + input[4] = false + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + bam(process.out.bam[0][1]).getHeader(), + bam(process.out.bam[0][1]).getReadsMD5(), + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - bam, fasta, true, 'bai', false, false") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test3.single_end.markduplicates.sorted.bam', checkIfExists: true) + ] + input[1] = [ + [ id:'test_ref' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + input[2] = true + input[3] = 'bai' + input[4] = false + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + bam(process.out.bam[0][1]).getHeader(), + bam(process.out.bam[0][1]).getReadsMD5(), + file(process.out.index[0][1]).name, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - bam, [], true, false, false") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test3.single_end.markduplicates.sorted.bam', checkIfExists: true) + ] + input[1] = [ + [ id:'test_ref' ], // meta map + [] + ] + input[2] = true + input[3] = [] + input[4] = false + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.failed } + ) + } + + } + + test("sarscov2 - fastq, fasta, true, [], false, false - stub") { + + options "-stub" + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ] + input[1] = [ + [ id:'test_ref' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + input[2] = true + input[3] = [] + input[4] = false + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("sarscov2 - fastq, fasta, true, 'bai', false, false - stub") { + + options "-stub" + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ] + input[1] = [ + [ id:'test_ref' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + input[2] = true + input[3] = 'bai' + input[4] = false + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("sarscov2 - fastq, fasta, false, [], false, false - stub") { + + options "-stub" + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ] + input[1] = [ + [ id:'test_ref' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + input[2] = false + input[3] = [] + input[4] = false + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("sarscov2 - bam, fasta, true, [], false, false - stub") { + + options "-stub" + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test3.single_end.markduplicates.sorted.bam', checkIfExists: true) + ] + input[1] = [ + [ id:'test_ref' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + input[2] = true + input[3] = [] + input[4] = false + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("sarscov2 - bam, fasta, true, 'bai', false, false - stub") { + + options "-stub" + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test3.single_end.markduplicates.sorted.bam', checkIfExists: true) + ] + input[1] = [ + [ id:'test_ref' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + input[2] = true + input[3] = 'bai' + input[4] = false + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("sarscov2 - bam, [], true, false, false - stub") { + + options "-stub" + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test3.single_end.markduplicates.sorted.bam', checkIfExists: true) + ] + input[1] = [ + [ id:'test_ref' ], // meta map + [] + ] + input[2] = true + input[3] = [] + input[4] = false + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.failed } + ) + } + + } + +} \ No newline at end of file diff --git a/modules/nf-core/minimap2/align/tests/main.nf.test.snap b/modules/nf-core/minimap2/align/tests/main.nf.test.snap new file mode 100644 index 0000000..12264a8 --- /dev/null +++ b/modules/nf-core/minimap2/align/tests/main.nf.test.snap @@ -0,0 +1,476 @@ +{ + "sarscov2 - bam, fasta, true, 'bai', false, false": { + "content": [ + [ + "@HD\tVN:1.6\tSO:coordinate", + "@SQ\tSN:MT192765.1\tLN:29829", + "@PG\tID:minimap2\tPN:minimap2\tVN:2.28-r1209\tCL:minimap2 -t 2 -a genome.fasta -", + "@PG\tID:samtools\tPN:samtools\tPP:minimap2\tVN:1.20\tCL:samtools sort -@ 1 -o test.bam##idx##test.bam.bai --write-index" + ], + "5d426b9a5f5b2c54f1d7f1e4c238ae94", + "test.bam.bai", + [ + "versions.yml:md5,3548eeba9066efbf8d78ea99f8d813fd" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-25T09:03:00.827260362" + }, + "sarscov2 - bam, fasta, true, 'bai', false, false - stub": { + "content": [ + { + "0": [ + + ], + "1": [ + [ + { + "id": "test", + "single_end": true + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": true + }, + "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + "versions.yml:md5,98b8f5f36aa54b82210094f0b0d11938" + ], + "bam": [ + [ + { + "id": "test", + "single_end": true + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "index": [ + [ + { + "id": "test", + "single_end": true + }, + "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "paf": [ + + ], + "versions": [ + "versions.yml:md5,98b8f5f36aa54b82210094f0b0d11938" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-23T11:21:37.92353539" + }, + "sarscov2 - fastq, fasta, true, 'bai', false, false - stub": { + "content": [ + { + "0": [ + + ], + "1": [ + [ + { + "id": "test", + "single_end": true + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": true + }, + "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + "versions.yml:md5,98b8f5f36aa54b82210094f0b0d11938" + ], + "bam": [ + [ + { + "id": "test", + "single_end": true + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "index": [ + [ + { + "id": "test", + "single_end": true + }, + "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "paf": [ + + ], + "versions": [ + "versions.yml:md5,98b8f5f36aa54b82210094f0b0d11938" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-03T11:29:44.669021368" + }, + "sarscov2 - fastq, fasta, false, [], false, false - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.paf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + + ], + "2": [ + + ], + "3": [ + "versions.yml:md5,98b8f5f36aa54b82210094f0b0d11938" + ], + "bam": [ + + ], + "index": [ + + ], + "paf": [ + [ + { + "id": "test", + "single_end": true + }, + "test.paf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,98b8f5f36aa54b82210094f0b0d11938" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-03T11:15:52.738781039" + }, + "sarscov2 - fastq, fasta, true, [], false, false - stub": { + "content": [ + { + "0": [ + + ], + "1": [ + [ + { + "id": "test", + "single_end": true + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + + ], + "3": [ + "versions.yml:md5,98b8f5f36aa54b82210094f0b0d11938" + ], + "bam": [ + [ + { + "id": "test", + "single_end": true + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "index": [ + + ], + "paf": [ + + ], + "versions": [ + "versions.yml:md5,98b8f5f36aa54b82210094f0b0d11938" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-03T11:15:23.033808223" + }, + "sarscov2 - [fastq1, fastq2], fasta, true, false, false": { + "content": [ + [ + "@HD\tVN:1.6\tSO:coordinate", + "@SQ\tSN:MT192765.1\tLN:29829", + "@PG\tID:minimap2\tPN:minimap2\tVN:2.28-r1209\tCL:minimap2 -t 2 -a genome.fasta test_1.fastq.gz test_2.fastq.gz", + "@PG\tID:samtools\tPN:samtools\tPP:minimap2\tVN:1.20\tCL:samtools sort -@ 1 -o test.bam" + ], + "1bc392244f228bf52cf0b5a8f6a654c9", + [ + "versions.yml:md5,3548eeba9066efbf8d78ea99f8d813fd" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-23T11:18:18.964586894" + }, + "sarscov2 - fastq, fasta, true, [], false, false": { + "content": [ + [ + "@HD\tVN:1.6\tSO:coordinate", + "@SQ\tSN:MT192765.1\tLN:29829", + "@PG\tID:minimap2\tPN:minimap2\tVN:2.28-r1209\tCL:minimap2 -t 2 -a genome.fasta test_1.fastq.gz", + "@PG\tID:samtools\tPN:samtools\tPP:minimap2\tVN:1.20\tCL:samtools sort -@ 1 -o test.bam" + ], + "f194745c0ccfcb2a9c0aee094a08750", + [ + "versions.yml:md5,3548eeba9066efbf8d78ea99f8d813fd" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-23T11:17:48.667488325" + }, + "sarscov2 - fastq, fasta, true, 'bai', false, false": { + "content": [ + [ + "@HD\tVN:1.6\tSO:coordinate", + "@SQ\tSN:MT192765.1\tLN:29829", + "@PG\tID:minimap2\tPN:minimap2\tVN:2.28-r1209\tCL:minimap2 -t 2 -a genome.fasta test_1.fastq.gz", + "@PG\tID:samtools\tPN:samtools\tPP:minimap2\tVN:1.20\tCL:samtools sort -@ 1 -o test.bam##idx##test.bam.bai --write-index" + ], + "f194745c0ccfcb2a9c0aee094a08750", + "test.bam.bai", + [ + "versions.yml:md5,3548eeba9066efbf8d78ea99f8d813fd" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-23T11:18:02.517416733" + }, + "sarscov2 - bam, fasta, true, [], false, false": { + "content": [ + [ + "@HD\tVN:1.6\tSO:coordinate", + "@SQ\tSN:MT192765.1\tLN:29829", + "@PG\tID:minimap2\tPN:minimap2\tVN:2.28-r1209\tCL:minimap2 -t 2 -a genome.fasta -", + "@PG\tID:samtools\tPN:samtools\tPP:minimap2\tVN:1.20\tCL:samtools sort -@ 1 -o test.bam" + ], + "5d426b9a5f5b2c54f1d7f1e4c238ae94", + [ + "versions.yml:md5,3548eeba9066efbf8d78ea99f8d813fd" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-25T09:02:49.64829488" + }, + "sarscov2 - bam, fasta, true, [], false, false - stub": { + "content": [ + { + "0": [ + + ], + "1": [ + [ + { + "id": "test", + "single_end": true + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + + ], + "3": [ + "versions.yml:md5,98b8f5f36aa54b82210094f0b0d11938" + ], + "bam": [ + [ + { + "id": "test", + "single_end": true + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "index": [ + + ], + "paf": [ + + ], + "versions": [ + "versions.yml:md5,98b8f5f36aa54b82210094f0b0d11938" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-23T11:21:22.162291795" + }, + "sarscov2 - fastq, [], true, false, false": { + "content": [ + [ + "@HD\tVN:1.6\tSO:coordinate", + "@SQ\tSN:ERR5069949.2151832\tLN:150", + "@SQ\tSN:ERR5069949.576388\tLN:77", + "@SQ\tSN:ERR5069949.501486\tLN:146", + "@SQ\tSN:ERR5069949.1331889\tLN:132", + "@SQ\tSN:ERR5069949.2161340\tLN:80", + "@SQ\tSN:ERR5069949.973930\tLN:79", + "@SQ\tSN:ERR5069949.2417063\tLN:150", + "@SQ\tSN:ERR5069949.376959\tLN:151", + "@SQ\tSN:ERR5069949.1088785\tLN:149", + "@SQ\tSN:ERR5069949.1066259\tLN:147", + "@SQ\tSN:ERR5069949.2832676\tLN:139", + "@SQ\tSN:ERR5069949.2953930\tLN:151", + "@SQ\tSN:ERR5069949.324865\tLN:151", + "@SQ\tSN:ERR5069949.2185111\tLN:150", + "@SQ\tSN:ERR5069949.937422\tLN:151", + "@SQ\tSN:ERR5069949.2431709\tLN:150", + "@SQ\tSN:ERR5069949.1246538\tLN:148", + "@SQ\tSN:ERR5069949.1189252\tLN:98", + "@SQ\tSN:ERR5069949.2216307\tLN:147", + "@SQ\tSN:ERR5069949.3273002\tLN:148", + "@SQ\tSN:ERR5069949.3277445\tLN:151", + "@SQ\tSN:ERR5069949.3022231\tLN:147", + "@SQ\tSN:ERR5069949.184542\tLN:151", + "@SQ\tSN:ERR5069949.540529\tLN:149", + "@SQ\tSN:ERR5069949.686090\tLN:150", + "@SQ\tSN:ERR5069949.2787556\tLN:106", + "@SQ\tSN:ERR5069949.2650879\tLN:150", + "@SQ\tSN:ERR5069949.2064910\tLN:149", + "@SQ\tSN:ERR5069949.2328704\tLN:150", + "@SQ\tSN:ERR5069949.1067032\tLN:150", + "@SQ\tSN:ERR5069949.3338256\tLN:151", + "@SQ\tSN:ERR5069949.1412839\tLN:147", + "@SQ\tSN:ERR5069949.1538968\tLN:150", + "@SQ\tSN:ERR5069949.147998\tLN:94", + "@SQ\tSN:ERR5069949.366975\tLN:106", + "@SQ\tSN:ERR5069949.1372331\tLN:151", + "@SQ\tSN:ERR5069949.1709367\tLN:129", + "@SQ\tSN:ERR5069949.2388984\tLN:150", + "@SQ\tSN:ERR5069949.1132353\tLN:150", + "@SQ\tSN:ERR5069949.1151736\tLN:151", + "@SQ\tSN:ERR5069949.479807\tLN:150", + "@SQ\tSN:ERR5069949.2176303\tLN:151", + "@SQ\tSN:ERR5069949.2772897\tLN:151", + "@SQ\tSN:ERR5069949.1020777\tLN:122", + "@SQ\tSN:ERR5069949.465452\tLN:151", + "@SQ\tSN:ERR5069949.1704586\tLN:149", + "@SQ\tSN:ERR5069949.1258508\tLN:151", + "@SQ\tSN:ERR5069949.986441\tLN:119", + "@SQ\tSN:ERR5069949.2674295\tLN:148", + "@SQ\tSN:ERR5069949.885966\tLN:79", + "@SQ\tSN:ERR5069949.2342766\tLN:151", + "@SQ\tSN:ERR5069949.3122970\tLN:127", + "@SQ\tSN:ERR5069949.3279513\tLN:72", + "@SQ\tSN:ERR5069949.309410\tLN:151", + "@SQ\tSN:ERR5069949.532979\tLN:149", + "@SQ\tSN:ERR5069949.2888794\tLN:151", + "@SQ\tSN:ERR5069949.2205229\tLN:150", + "@SQ\tSN:ERR5069949.786562\tLN:151", + "@SQ\tSN:ERR5069949.919671\tLN:151", + "@SQ\tSN:ERR5069949.1328186\tLN:151", + "@SQ\tSN:ERR5069949.870926\tLN:149", + "@SQ\tSN:ERR5069949.2257580\tLN:151", + "@SQ\tSN:ERR5069949.3249622\tLN:77", + "@SQ\tSN:ERR5069949.611123\tLN:125", + "@SQ\tSN:ERR5069949.651338\tLN:142", + "@SQ\tSN:ERR5069949.169513\tLN:92", + "@SQ\tSN:ERR5069949.155944\tLN:150", + "@SQ\tSN:ERR5069949.2033605\tLN:150", + "@SQ\tSN:ERR5069949.2730382\tLN:142", + "@SQ\tSN:ERR5069949.2125592\tLN:150", + "@SQ\tSN:ERR5069949.1062611\tLN:151", + "@SQ\tSN:ERR5069949.1778133\tLN:151", + "@SQ\tSN:ERR5069949.3057020\tLN:95", + "@SQ\tSN:ERR5069949.2972968\tLN:141", + "@SQ\tSN:ERR5069949.2734474\tLN:149", + "@SQ\tSN:ERR5069949.856527\tLN:151", + "@SQ\tSN:ERR5069949.2098070\tLN:151", + "@SQ\tSN:ERR5069949.1552198\tLN:150", + "@SQ\tSN:ERR5069949.2385514\tLN:150", + "@SQ\tSN:ERR5069949.2270078\tLN:151", + "@SQ\tSN:ERR5069949.114870\tLN:150", + "@SQ\tSN:ERR5069949.2668880\tLN:147", + "@SQ\tSN:ERR5069949.257821\tLN:139", + "@SQ\tSN:ERR5069949.2243023\tLN:150", + "@SQ\tSN:ERR5069949.2605155\tLN:146", + "@SQ\tSN:ERR5069949.1340552\tLN:151", + "@SQ\tSN:ERR5069949.1561137\tLN:150", + "@SQ\tSN:ERR5069949.2361683\tLN:149", + "@SQ\tSN:ERR5069949.2521353\tLN:150", + "@SQ\tSN:ERR5069949.1261808\tLN:149", + "@SQ\tSN:ERR5069949.2734873\tLN:98", + "@SQ\tSN:ERR5069949.3017828\tLN:107", + "@SQ\tSN:ERR5069949.573706\tLN:150", + "@SQ\tSN:ERR5069949.1980512\tLN:151", + "@SQ\tSN:ERR5069949.1014693\tLN:150", + "@SQ\tSN:ERR5069949.3184655\tLN:150", + "@SQ\tSN:ERR5069949.29668\tLN:89", + "@SQ\tSN:ERR5069949.3258358\tLN:151", + "@SQ\tSN:ERR5069949.1476386\tLN:151", + "@SQ\tSN:ERR5069949.2415814\tLN:150", + "@PG\tID:minimap2\tPN:minimap2\tVN:2.28-r1209\tCL:minimap2 -t 2 -a test_1.fastq.gz test_1.fastq.gz", + "@PG\tID:samtools\tPN:samtools\tPP:minimap2\tVN:1.20\tCL:samtools sort -@ 1 -o test.bam" + ], + "16c1c651f8ec67383bcdee3c55aed94f", + [ + "versions.yml:md5,3548eeba9066efbf8d78ea99f8d813fd" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-23T11:18:34.246998277" + } +} \ No newline at end of file diff --git a/modules/nf-core/minimap2/align/tests/tags.yml b/modules/nf-core/minimap2/align/tests/tags.yml new file mode 100644 index 0000000..39dba37 --- /dev/null +++ b/modules/nf-core/minimap2/align/tests/tags.yml @@ -0,0 +1,2 @@ +minimap2/align: + - "modules/nf-core/minimap2/align/**" diff --git a/modules/nf-core/samtools/collate/environment.yml b/modules/nf-core/samtools/collate/environment.yml index 0fb861b..62054fc 100644 --- a/modules/nf-core/samtools/collate/environment.yml +++ b/modules/nf-core/samtools/collate/environment.yml @@ -1,7 +1,8 @@ -name: samtools_collate +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda - - defaults dependencies: - - bioconda::samtools=1.17 + - bioconda::htslib=1.21 + - bioconda::samtools=1.21 diff --git a/modules/nf-core/samtools/collate/main.nf b/modules/nf-core/samtools/collate/main.nf index 38a4daf..a0d831f 100644 --- a/modules/nf-core/samtools/collate/main.nf +++ b/modules/nf-core/samtools/collate/main.nf @@ -4,12 +4,12 @@ process SAMTOOLS_COLLATE { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/samtools:1.17--h00cdaf9_0': - 'biocontainers/samtools:1.17--h00cdaf9_0' }" + 'https://depot.galaxyproject.org/singularity/samtools:1.21--h50ea8bc_0': + 'biocontainers/samtools:1.21--h50ea8bc_0' }" input: tuple val(meta), path(input) - path fasta + tuple val(meta2), path(fasta) output: tuple val(meta), path("*.bam"), emit: bam, optional: true diff --git a/modules/nf-core/samtools/collate/meta.yml b/modules/nf-core/samtools/collate/meta.yml index 3c79927..cc54583 100644 --- a/modules/nf-core/samtools/collate/meta.yml +++ b/modules/nf-core/samtools/collate/meta.yml @@ -3,6 +3,8 @@ description: shuffles and groups reads together by their names keywords: - collate - bam + - sam + - cram tools: - "samtools": description: "Tools for dealing with SAM, BAM and CRAM files" @@ -10,33 +12,65 @@ tools: documentation: "https://www.htslib.org/doc/samtools-collate.html" tool_dev_url: "https://github.com/samtools/samtools" doi: "10.1093/bioinformatics/btp352" - licence: "['MIT']" + licence: ["MIT"] + identifier: biotools:samtools input: # Only when we have meta - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - input: - type: file - description: BAM/CRAM/SAM file - pattern: "*.{bam,cram,sam}" + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - input: + type: file + description: BAM/CRAM/SAM file + pattern: "*.{bam,cram,sam}" + - - meta2: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - fasta: + type: file + description: FASTA ref file + pattern: "*.fasta" output: #Only when we have meta - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] + - bam: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.bam": + type: file + description: Sorted BAM + pattern: "*.{bam}" + - cram: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.cram": + type: file + description: Sorted CRAM + pattern: "*.{cram}" + - sam: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.sam": + type: file + description: Sorted SAM + pattern: "*.{sam}" - versions: - type: file - description: File containing software versions - pattern: "versions.yml" - - output: - type: file - description: Collated BAM/CRAM/SAM file - pattern: "*.{bam,cram,sam}" + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@priyanka-surana" maintainers: diff --git a/modules/nf-core/samtools/collate/tests/main.nf.test b/modules/nf-core/samtools/collate/tests/main.nf.test new file mode 100644 index 0000000..875f0e9 --- /dev/null +++ b/modules/nf-core/samtools/collate/tests/main.nf.test @@ -0,0 +1,67 @@ +nextflow_process { + + name "Test Process SAMTOOLS_COLLATE" + script "../main.nf" + process "SAMTOOLS_COLLATE" + + tag "modules" + tag "modules_nfcore" + tag "samtools" + tag "samtools/collate" + + test("sarscov2 - bam") { + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.bam', checkIfExists: true) + ]) + input[1] = [ [id:'fasta'], [] ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(file(process.out.bam[0][1]).name).match("bam_bam") }, + { assert snapshot(process.out.cram).match("bam_cram") }, + { assert snapshot(process.out.sam).match("bam_sam") }, + { assert snapshot(process.out.versions).match("bam_versions") } + ) + } + + } + + test("homo_sapiens - cram + fasta") { + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true) + ]) + input[1] = Channel.of([ + [ id:'fasta'], + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(file(process.out.bam[0][1]).name).match("cram_fasta_bam") }, + { assert snapshot(process.out.cram).match("cram_fasta_cram") }, + { assert snapshot(process.out.sam).match("cram_fasta_sam") }, + { assert snapshot(process.out.versions).match("cram_fasta_versions") } + ) + } + + } + +} diff --git a/modules/nf-core/samtools/collate/tests/main.nf.test.snap b/modules/nf-core/samtools/collate/tests/main.nf.test.snap new file mode 100644 index 0000000..4d22136 --- /dev/null +++ b/modules/nf-core/samtools/collate/tests/main.nf.test.snap @@ -0,0 +1,94 @@ +{ + "cram_fasta_versions": { + "content": [ + [ + "versions.yml:md5,354d4c20293fa674e56f96d5f7db6580" + ] + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-16T07:48:41.845649492" + }, + "bam_cram": { + "content": [ + [ + + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.04.3" + }, + "timestamp": "2024-02-02T16:56:01.611698" + }, + "cram_fasta_cram": { + "content": [ + [ + + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.04.3" + }, + "timestamp": "2024-02-02T16:56:48.325375" + }, + "cram_fasta_sam": { + "content": [ + [ + + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.04.3" + }, + "timestamp": "2024-02-02T16:56:48.328907" + }, + "cram_fasta_bam": { + "content": [ + "test.bam" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.04.3" + }, + "timestamp": "2024-02-02T16:56:48.322144" + }, + "bam_bam": { + "content": [ + "test.bam" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.04.3" + }, + "timestamp": "2024-02-02T16:56:01.608677" + }, + "bam_sam": { + "content": [ + [ + + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.04.3" + }, + "timestamp": "2024-02-02T16:56:01.613225" + }, + "bam_versions": { + "content": [ + [ + "versions.yml:md5,354d4c20293fa674e56f96d5f7db6580" + ] + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-16T07:48:29.622364238" + } +} \ No newline at end of file diff --git a/modules/nf-core/samtools/collate/tests/tags.yml b/modules/nf-core/samtools/collate/tests/tags.yml new file mode 100644 index 0000000..9c09270 --- /dev/null +++ b/modules/nf-core/samtools/collate/tests/tags.yml @@ -0,0 +1,2 @@ +samtools/collate: + - "modules/nf-core/samtools/collate/**" diff --git a/modules/nf-core/samtools/faidx/environment.yml b/modules/nf-core/samtools/faidx/environment.yml new file mode 100644 index 0000000..62054fc --- /dev/null +++ b/modules/nf-core/samtools/faidx/environment.yml @@ -0,0 +1,8 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json +channels: + - conda-forge + - bioconda +dependencies: + - bioconda::htslib=1.21 + - bioconda::samtools=1.21 diff --git a/modules/nf-core/samtools/faidx/main.nf b/modules/nf-core/samtools/faidx/main.nf index 59ed308..28c0a81 100644 --- a/modules/nf-core/samtools/faidx/main.nf +++ b/modules/nf-core/samtools/faidx/main.nf @@ -2,10 +2,10 @@ process SAMTOOLS_FAIDX { tag "$fasta" label 'process_single' - conda "bioconda::samtools=1.17" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/samtools:1.17--h00cdaf9_0' : - 'biocontainers/samtools:1.17--h00cdaf9_0' }" + 'https://depot.galaxyproject.org/singularity/samtools:1.21--h50ea8bc_0' : + 'biocontainers/samtools:1.21--h50ea8bc_0' }" input: tuple val(meta), path(fasta) diff --git a/modules/nf-core/samtools/faidx/meta.yml b/modules/nf-core/samtools/faidx/meta.yml index 957b25e..6721b2c 100644 --- a/modules/nf-core/samtools/faidx/meta.yml +++ b/modules/nf-core/samtools/faidx/meta.yml @@ -14,44 +14,67 @@ tools: documentation: http://www.htslib.org/doc/samtools.html doi: 10.1093/bioinformatics/btp352 licence: ["MIT"] + identifier: biotools:samtools input: - - meta: - type: map - description: | - Groovy Map containing reference information - e.g. [ id:'test' ] - - fasta: - type: file - description: FASTA file - pattern: "*.{fa,fasta}" - - meta2: - type: map - description: | - Groovy Map containing reference information - e.g. [ id:'test' ] - - fai: - type: file - description: FASTA index file - pattern: "*.{fai}" + - - meta: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'test' ] + - fasta: + type: file + description: FASTA file + pattern: "*.{fa,fasta}" + - - meta2: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'test' ] + - fai: + type: file + description: FASTA index file + pattern: "*.{fai}" output: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] + - fa: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.{fa,fasta}": + type: file + description: FASTA file + pattern: "*.{fa}" - fai: - type: file - description: FASTA index file - pattern: "*.{fai}" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.fai": + type: file + description: FASTA index file + pattern: "*.{fai}" - gzi: - type: file - description: Optional gzip index file for compressed inputs - pattern: "*.gzi" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.gzi": + type: file + description: Optional gzip index file for compressed inputs + pattern: "*.gzi" - versions: - type: file - description: File containing software versions - pattern: "versions.yml" + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@drpatelh" - "@ewels" - "@phue" +maintainers: + - "@drpatelh" + - "@ewels" + - "@phue" diff --git a/modules/nf-core/samtools/faidx/tests/main.nf.test b/modules/nf-core/samtools/faidx/tests/main.nf.test new file mode 100644 index 0000000..17244ef --- /dev/null +++ b/modules/nf-core/samtools/faidx/tests/main.nf.test @@ -0,0 +1,122 @@ +nextflow_process { + + name "Test Process SAMTOOLS_FAIDX" + script "../main.nf" + process "SAMTOOLS_FAIDX" + + tag "modules" + tag "modules_nfcore" + tag "samtools" + tag "samtools/faidx" + + test("test_samtools_faidx") { + + when { + process { + """ + input[0] = [ [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) ] + + input[1] = [[],[]] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_samtools_faidx_bgzip") { + + when { + process { + """ + input[0] = [ [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.gz', checkIfExists: true)] + + input[1] = [[],[]] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_samtools_faidx_fasta") { + + config "./nextflow.config" + + when { + process { + """ + input[0] = [ [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) ] + + input[1] = [ [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true) ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_samtools_faidx_stub_fasta") { + + config "./nextflow2.config" + + when { + process { + """ + input[0] = [ [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) ] + + input[1] = [ [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true) ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_samtools_faidx_stub_fai") { + + when { + process { + """ + input[0] = [ [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) ] + + input[1] = [[],[]] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } +} \ No newline at end of file diff --git a/modules/nf-core/samtools/faidx/tests/main.nf.test.snap b/modules/nf-core/samtools/faidx/tests/main.nf.test.snap new file mode 100644 index 0000000..1bbb3ec --- /dev/null +++ b/modules/nf-core/samtools/faidx/tests/main.nf.test.snap @@ -0,0 +1,249 @@ +{ + "test_samtools_faidx": { + "content": [ + { + "0": [ + + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "genome.fasta.fai:md5,9da2a56e2853dc8c0b86a9e7229c9fe5" + ] + ], + "2": [ + + ], + "3": [ + "versions.yml:md5,6bbe80a2e14bd61202ca63e12d66027f" + ], + "fa": [ + + ], + "fai": [ + [ + { + "id": "test", + "single_end": false + }, + "genome.fasta.fai:md5,9da2a56e2853dc8c0b86a9e7229c9fe5" + ] + ], + "gzi": [ + + ], + "versions": [ + "versions.yml:md5,6bbe80a2e14bd61202ca63e12d66027f" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-16T07:57:47.450887871" + }, + "test_samtools_faidx_bgzip": { + "content": [ + { + "0": [ + + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "genome.fasta.gz.fai:md5,9da2a56e2853dc8c0b86a9e7229c9fe5" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "genome.fasta.gz.gzi:md5,7dea362b3fac8e00956a4952a3d4f474" + ] + ], + "3": [ + "versions.yml:md5,6bbe80a2e14bd61202ca63e12d66027f" + ], + "fa": [ + + ], + "fai": [ + [ + { + "id": "test", + "single_end": false + }, + "genome.fasta.gz.fai:md5,9da2a56e2853dc8c0b86a9e7229c9fe5" + ] + ], + "gzi": [ + [ + { + "id": "test", + "single_end": false + }, + "genome.fasta.gz.gzi:md5,7dea362b3fac8e00956a4952a3d4f474" + ] + ], + "versions": [ + "versions.yml:md5,6bbe80a2e14bd61202ca63e12d66027f" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-16T07:58:04.804905659" + }, + "test_samtools_faidx_fasta": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "extract.fa:md5,6a0774a0ad937ba0bfd2ac7457d90f36" + ] + ], + "1": [ + + ], + "2": [ + + ], + "3": [ + "versions.yml:md5,6bbe80a2e14bd61202ca63e12d66027f" + ], + "fa": [ + [ + { + "id": "test", + "single_end": false + }, + "extract.fa:md5,6a0774a0ad937ba0bfd2ac7457d90f36" + ] + ], + "fai": [ + + ], + "gzi": [ + + ], + "versions": [ + "versions.yml:md5,6bbe80a2e14bd61202ca63e12d66027f" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-16T07:58:23.831268154" + }, + "test_samtools_faidx_stub_fasta": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "extract.fa:md5,9da2a56e2853dc8c0b86a9e7229c9fe5" + ] + ], + "1": [ + + ], + "2": [ + + ], + "3": [ + "versions.yml:md5,6bbe80a2e14bd61202ca63e12d66027f" + ], + "fa": [ + [ + { + "id": "test", + "single_end": false + }, + "extract.fa:md5,9da2a56e2853dc8c0b86a9e7229c9fe5" + ] + ], + "fai": [ + + ], + "gzi": [ + + ], + "versions": [ + "versions.yml:md5,6bbe80a2e14bd61202ca63e12d66027f" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-16T07:58:35.600243706" + }, + "test_samtools_faidx_stub_fai": { + "content": [ + { + "0": [ + + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "genome.fasta.fai:md5,9da2a56e2853dc8c0b86a9e7229c9fe5" + ] + ], + "2": [ + + ], + "3": [ + "versions.yml:md5,6bbe80a2e14bd61202ca63e12d66027f" + ], + "fa": [ + + ], + "fai": [ + [ + { + "id": "test", + "single_end": false + }, + "genome.fasta.fai:md5,9da2a56e2853dc8c0b86a9e7229c9fe5" + ] + ], + "gzi": [ + + ], + "versions": [ + "versions.yml:md5,6bbe80a2e14bd61202ca63e12d66027f" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-16T07:58:54.705460167" + } +} \ No newline at end of file diff --git a/modules/nf-core/samtools/faidx/tests/nextflow.config b/modules/nf-core/samtools/faidx/tests/nextflow.config new file mode 100644 index 0000000..f76a3ba --- /dev/null +++ b/modules/nf-core/samtools/faidx/tests/nextflow.config @@ -0,0 +1,7 @@ +process { + + withName: SAMTOOLS_FAIDX { + ext.args = 'MT192765.1 -o extract.fa' + } + +} diff --git a/modules/nf-core/samtools/faidx/tests/nextflow2.config b/modules/nf-core/samtools/faidx/tests/nextflow2.config new file mode 100644 index 0000000..33ebbd5 --- /dev/null +++ b/modules/nf-core/samtools/faidx/tests/nextflow2.config @@ -0,0 +1,6 @@ +process { + + withName: SAMTOOLS_FAIDX { + ext.args = '-o extract.fa' + } +} diff --git a/modules/nf-core/samtools/faidx/tests/tags.yml b/modules/nf-core/samtools/faidx/tests/tags.yml new file mode 100644 index 0000000..e4a8394 --- /dev/null +++ b/modules/nf-core/samtools/faidx/tests/tags.yml @@ -0,0 +1,2 @@ +samtools/faidx: + - modules/nf-core/samtools/faidx/** diff --git a/modules/nf-core/samtools/fasta/environment.yml b/modules/nf-core/samtools/fasta/environment.yml index 8a82f9e..62054fc 100644 --- a/modules/nf-core/samtools/fasta/environment.yml +++ b/modules/nf-core/samtools/fasta/environment.yml @@ -1,7 +1,8 @@ -name: samtools_fasta +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda - - defaults dependencies: - - bioconda::samtools=1.17 + - bioconda::htslib=1.21 + - bioconda::samtools=1.21 diff --git a/modules/nf-core/samtools/fasta/main.nf b/modules/nf-core/samtools/fasta/main.nf index dc4ad98..1c42141 100644 --- a/modules/nf-core/samtools/fasta/main.nf +++ b/modules/nf-core/samtools/fasta/main.nf @@ -4,8 +4,8 @@ process SAMTOOLS_FASTA { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/samtools:1.17--h00cdaf9_0' : - 'biocontainers/samtools:1.17--h00cdaf9_0' }" + 'https://depot.galaxyproject.org/singularity/samtools:1.21--h50ea8bc_0' : + 'biocontainers/samtools:1.21--h50ea8bc_0' }" input: tuple val(meta), path(input) @@ -24,7 +24,7 @@ process SAMTOOLS_FASTA { script: def args = task.ext.args ?: '' def prefix = task.ext.prefix ?: "${meta.id}" - def output = ( interleave && ! meta.single_end ) ? "> ${prefix}_interleaved.fasta.gz" : + def output = ( interleave && ! meta.single_end ) ? "| gzip > ${prefix}_interleaved.fasta.gz" : meta.single_end ? "-1 ${prefix}_1.fasta.gz -s ${prefix}_singleton.fasta.gz" : "-1 ${prefix}_1.fasta.gz -2 ${prefix}_2.fasta.gz -s ${prefix}_singleton.fasta.gz" """ diff --git a/modules/nf-core/samtools/fasta/meta.yml b/modules/nf-core/samtools/fasta/meta.yml index eae26f0..6ea7763 100644 --- a/modules/nf-core/samtools/fasta/meta.yml +++ b/modules/nf-core/samtools/fasta/meta.yml @@ -13,47 +13,71 @@ tools: tool_dev_url: "https://github.com/samtools/samtools" doi: "10.1093/bioinformatics/btp352" licence: ["MIT"] + identifier: biotools:samtools input: # Only when we have meta - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - input: - type: file - description: BAM/CRAM/SAM file - pattern: "*.{bam,cram,sam}" - - interleave: - type: boolean - description: Set true for interleaved fasta files + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - input: + type: file + description: BAM/CRAM/SAM file + pattern: "*.{bam,cram,sam}" + - - interleave: + type: boolean + description: Set true for interleaved fasta files output: #Only when we have meta - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - versions: - type: file - description: File containing software versions - pattern: "versions.yml" - fasta: - type: file - description: Compressed FASTA file(s) with reads with either the READ1 or READ2 flag set in separate files. - pattern: "*_{1,2}.fasta.gz" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*_{1,2}.fasta.gz": + type: file + description: Compressed FASTA file(s) with reads with either the READ1 or READ2 + flag set in separate files. + pattern: "*_{1,2}.fasta.gz" - interleaved: - type: file - description: Compressed FASTA file with reads with either the READ1 or READ2 flag set in a combined file. Needs collated input file. - pattern: "*_interleaved.fasta.gz" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*_interleaved.fasta.gz": + type: file + description: Compressed FASTA file with reads with either the READ1 or READ2 + flag set in a combined file. Needs collated input file. + pattern: "*_interleaved.fasta.gz" - singleton: - type: file - description: Compressed FASTA file with singleton reads - pattern: "*_singleton.fasta.gz" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*_singleton.fasta.gz": + type: file + description: Compressed FASTA file with singleton reads + pattern: "*_singleton.fasta.gz" - other: - type: file - description: Compressed FASTA file with reads with either both READ1 and READ2 flags set or unset - pattern: "*_other.fasta.gz" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*_other.fasta.gz": + type: file + description: Compressed FASTA file with reads with either both READ1 and READ2 + flags set or unset + pattern: "*_other.fasta.gz" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@priyanka-surana" maintainers: diff --git a/modules/nf-core/samtools/fasta/tests/main.nf.test b/modules/nf-core/samtools/fasta/tests/main.nf.test new file mode 100644 index 0000000..30d0c25 --- /dev/null +++ b/modules/nf-core/samtools/fasta/tests/main.nf.test @@ -0,0 +1,70 @@ + +nextflow_process { + + name "Test Process SAMTOOLS_FASTA" + script "../main.nf" + process "SAMTOOLS_FASTA" + + tag "modules" + tag "modules_nfcore" + tag "samtools" + tag "samtools/fasta" + + test("test-samtools-fasta") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.bam', checkIfExists: true) + ] + input[1] = false + + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + process.out.fasta[0][1].collect { file(it).name }.toSorted(), + file(process.out.singleton[0][1]).name, + file(process.out.other[0][1]).name, + process.out.versions + ).match() + } + ) + } + } + + test("test-samtools-fasta-interleave") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.bam', checkIfExists: true) + ] + input[1] = true + + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + path(process.out.interleaved[0][1]).linesGzip[0], + file(process.out.other[0][1]).name, + process.out.versions + ).match() + } + ) + } + } + +} diff --git a/modules/nf-core/samtools/fasta/tests/main.nf.test.snap b/modules/nf-core/samtools/fasta/tests/main.nf.test.snap new file mode 100644 index 0000000..6c26c7e --- /dev/null +++ b/modules/nf-core/samtools/fasta/tests/main.nf.test.snap @@ -0,0 +1,34 @@ +{ + "test-samtools-fasta": { + "content": [ + [ + "test_1.fasta.gz", + "test_2.fasta.gz" + ], + "test_singleton.fasta.gz", + "test_other.fasta.gz", + [ + "versions.yml:md5,da649728a4a937a64cb8865ebc9ace81" + ] + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-16T07:59:47.290462747" + }, + "test-samtools-fasta-interleave": { + "content": [ + ">ERR5069949.2151832/1", + "test_other.fasta.gz", + [ + "versions.yml:md5,da649728a4a937a64cb8865ebc9ace81" + ] + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-16T07:59:59.597655297" + } +} \ No newline at end of file diff --git a/modules/nf-core/samtools/fastq/environment.yml b/modules/nf-core/samtools/fastq/environment.yml index 1b7124d..62054fc 100644 --- a/modules/nf-core/samtools/fastq/environment.yml +++ b/modules/nf-core/samtools/fastq/environment.yml @@ -1,7 +1,8 @@ -name: samtools_fastq +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda - - defaults dependencies: - - bioconda::samtools=1.17 + - bioconda::htslib=1.21 + - bioconda::samtools=1.21 diff --git a/modules/nf-core/samtools/fastq/main.nf b/modules/nf-core/samtools/fastq/main.nf index ed8d755..136744d 100644 --- a/modules/nf-core/samtools/fastq/main.nf +++ b/modules/nf-core/samtools/fastq/main.nf @@ -4,8 +4,8 @@ process SAMTOOLS_FASTQ { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/samtools:1.17--h00cdaf9_0' : - 'biocontainers/samtools:1.17--h00cdaf9_0' }" + 'https://depot.galaxyproject.org/singularity/samtools:1.21--h50ea8bc_0' : + 'biocontainers/samtools:1.21--h50ea8bc_0' }" input: tuple val(meta), path(input) @@ -13,7 +13,7 @@ process SAMTOOLS_FASTQ { output: tuple val(meta), path("*_{1,2}.fastq.gz") , optional:true, emit: fastq - tuple val(meta), path("*_interleaved.fastq.gz"), optional:true, emit: interleaved + tuple val(meta), path("*_interleaved.fastq") , optional:true, emit: interleaved tuple val(meta), path("*_singleton.fastq.gz") , optional:true, emit: singleton tuple val(meta), path("*_other.fastq.gz") , optional:true, emit: other path "versions.yml" , emit: versions @@ -24,7 +24,7 @@ process SAMTOOLS_FASTQ { script: def args = task.ext.args ?: '' def prefix = task.ext.prefix ?: "${meta.id}" - def output = ( interleave && ! meta.single_end ) ? "> ${prefix}_interleaved.fastq.gz" : + def output = ( interleave && ! meta.single_end ) ? "> ${prefix}_interleaved.fastq" : meta.single_end ? "-1 ${prefix}_1.fastq.gz -s ${prefix}_singleton.fastq.gz" : "-1 ${prefix}_1.fastq.gz -2 ${prefix}_2.fastq.gz -s ${prefix}_singleton.fastq.gz" """ diff --git a/modules/nf-core/samtools/fastq/meta.yml b/modules/nf-core/samtools/fastq/meta.yml index c4002a4..c15a0b6 100644 --- a/modules/nf-core/samtools/fastq/meta.yml +++ b/modules/nf-core/samtools/fastq/meta.yml @@ -15,45 +15,69 @@ tools: documentation: http://www.htslib.org/doc/samtools.html doi: 10.1093/bioinformatics/btp352 licence: ["MIT"] + identifier: biotools:samtools input: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - input: - type: file - description: BAM/CRAM/SAM file - pattern: "*.{bam,cram,sam}" - - interleave: - type: boolean - description: Set true for interleaved fastq file + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - input: + type: file + description: BAM/CRAM/SAM file + pattern: "*.{bam,cram,sam}" + - - interleave: + type: boolean + description: Set true for interleaved fastq file output: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - versions: - type: file - description: File containing software versions - pattern: "versions.yml" - fastq: - type: file - description: Compressed FASTQ file(s) with reads with either the READ1 or READ2 flag set in separate files. - pattern: "*_{1,2}.fastq.gz" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*_{1,2}.fastq.gz": + type: file + description: Compressed FASTQ file(s) with reads with either the READ1 or READ2 + flag set in separate files. + pattern: "*_{1,2}.fastq.gz" - interleaved: - type: file - description: Compressed FASTQ file with reads with either the READ1 or READ2 flag set in a combined file. Needs collated input file. - pattern: "*_interleaved.fastq.gz" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*_interleaved.fastq": + type: file + description: Compressed FASTQ file with reads with either the READ1 or READ2 + flag set in a combined file. Needs collated input file. + pattern: "*_interleaved.fastq.gz" - singleton: - type: file - description: Compressed FASTQ file with singleton reads - pattern: "*_singleton.fastq.gz" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*_singleton.fastq.gz": + type: file + description: Compressed FASTQ file with singleton reads + pattern: "*_singleton.fastq.gz" - other: - type: file - description: Compressed FASTQ file with reads with either both READ1 and READ2 flags set or unset - pattern: "*_other.fastq.gz" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*_other.fastq.gz": + type: file + description: Compressed FASTQ file with reads with either both READ1 and READ2 + flags set or unset + pattern: "*_other.fastq.gz" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@priyanka-surana" - "@suzannejin" diff --git a/modules/nf-core/samtools/fastq/tests/main.nf.test b/modules/nf-core/samtools/fastq/tests/main.nf.test new file mode 100644 index 0000000..f6ac112 --- /dev/null +++ b/modules/nf-core/samtools/fastq/tests/main.nf.test @@ -0,0 +1,67 @@ +nextflow_process { + + name "Test Process SAMTOOLS_FASTQ" + script "../main.nf" + process "SAMTOOLS_FASTQ" + + tag "modules" + tag "modules_nfcore" + tag "samtools" + tag "samtools/fastq" + + test("bam") { + + when { + process { + """ + interleave = false + + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.bam', checkIfExists: true) + ]) + input[1] = interleave + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out.fastq[0][1].collect { path(it).linesGzip[0..6] }).match("bam_fastq") }, + { assert snapshot(process.out.interleaved).match("bam_interleaved") }, + { assert snapshot(file(process.out.singleton[0][1]).name).match("bam_singleton") }, + { assert snapshot(file(process.out.other[0][1]).name).match("bam_other") }, + { assert snapshot(process.out.versions).match("bam_versions") } + ) + } + } + + test("bam_interleave") { + + when { + process { + """ + interleave = true + + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.bam', checkIfExists: true) + ]) + input[1] = interleave + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out.fastq).match("bam_interleave_fastq") }, + { assert snapshot(path(process.out.interleaved[0][1]).readLines()[0..6]).match("bam_interlinterleave_eaved") }, + { assert snapshot(process.out.singleton).match("bam_singinterleave_leton") }, + { assert snapshot(file(process.out.other[0][1]).name).match("bam_interleave_other") }, + { assert snapshot(process.out.versions).match("bam_verinterleave_sions") } + ) + } + } +} diff --git a/modules/nf-core/samtools/fastq/tests/main.nf.test.snap b/modules/nf-core/samtools/fastq/tests/main.nf.test.snap new file mode 100644 index 0000000..10e5cd3 --- /dev/null +++ b/modules/nf-core/samtools/fastq/tests/main.nf.test.snap @@ -0,0 +1,139 @@ +{ + "bam_interlinterleave_eaved": { + "content": [ + [ + "@ERR5069949.2151832/1", + "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT", + "+", + "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE