From 151e154cbe129f211e1d085a33893d7b7a73ecc1 Mon Sep 17 00:00:00 2001 From: Tyler Chafin Date: Tue, 19 Nov 2024 20:37:51 +0000 Subject: [PATCH 01/10] modules partially updated; stuck on samtools/view --- .params_2024-11-19_19-46-41.json | 57 +++ modules.json | 24 +- modules/nf-core/cat/cat/environment.yml | 2 - modules/nf-core/cat/cat/main.nf | 1 - modules/nf-core/cat/cat/meta.yml | 39 +- modules/nf-core/cat/cat/tests/main.nf.test | 27 +- .../nf-core/cat/cat/tests/main.nf.test.snap | 74 ++- .../dumpsoftwareversions/environment.yml | 2 - .../custom/dumpsoftwareversions/meta.yml | 36 +- .../templates/dumpsoftwareversions.py | 4 +- modules/nf-core/gunzip/environment.yml | 6 +- modules/nf-core/gunzip/main.nf | 17 +- modules/nf-core/gunzip/meta.yml | 38 +- modules/nf-core/gunzip/tests/main.nf.test | 85 ++++ .../nf-core/gunzip/tests/main.nf.test.snap | 103 ++++ modules/nf-core/gunzip/tests/nextflow.config | 5 + .../nf-core/minimap2/align/environment.yml | 9 +- modules/nf-core/minimap2/align/main.nf | 38 +- modules/nf-core/minimap2/align/meta.yml | 112 +++-- .../minimap2/align/minimap2-align.diff | 24 +- .../nf-core/minimap2/align/tests/main.nf.test | 318 ++++++++++-- .../minimap2/align/tests/main.nf.test.snap | 457 +++++++++++++++++- modules/nf-core/multiqc/environment.yml | 4 +- modules/nf-core/multiqc/main.nf | 16 +- modules/nf-core/multiqc/meta.yml | 78 +-- modules/nf-core/multiqc/tests/main.nf.test | 8 + .../nf-core/multiqc/tests/main.nf.test.snap | 24 +- modules/nf-core/multiqc/tests/nextflow.config | 5 + modules/nf-core/pigz/compress/environment.yml | 2 - modules/nf-core/pigz/compress/meta.yml | 49 +- .../nf-core/pigz/compress/tests/main.nf.test | 10 +- .../pigz/compress/tests/main.nf.test.snap | 15 +- .../nf-core/samtools/flagstat/environment.yml | 8 +- modules/nf-core/samtools/flagstat/main.nf | 4 +- modules/nf-core/samtools/flagstat/meta.yml | 54 ++- .../samtools/flagstat/tests/main.nf.test | 28 +- .../samtools/flagstat/tests/main.nf.test.snap | 78 ++- .../nf-core/samtools/index/environment.yml | 8 +- modules/nf-core/samtools/index/main.nf | 11 +- modules/nf-core/samtools/index/meta.yml | 68 +-- .../nf-core/samtools/index/tests/main.nf.test | 87 +++- .../samtools/index/tests/main.nf.test.snap | 264 ++++++++-- modules/nf-core/samtools/view/environment.yml | 10 +- modules/nf-core/samtools/view/main.nf | 44 +- modules/nf-core/samtools/view/meta.yml | 158 ++++-- .../nf-core/samtools/view/tests/main.nf.test | 2 + .../samtools/view/tests/main.nf.test.snap | 88 +++- modules/nf-core/seqtk/subseq/environment.yml | 2 - modules/nf-core/seqtk/subseq/meta.yml | 45 +- .../nf-core/seqtk/subseq/tests/main.nf.test | 8 +- .../windowmasker/mkcounts/environment.yml | 2 - .../nf-core/windowmasker/mkcounts/meta.yml | 45 +- .../windowmasker/mkcounts/tests/main.nf.test | 4 +- .../windowmasker/ustat/environment.yml | 2 - modules/nf-core/windowmasker/ustat/meta.yml | 63 +-- .../windowmasker/ustat/tests/main.nf.test | 6 +- nextflow.config | 7 + workflows/blobtoolkit.nf | 4 +- 58 files changed, 2130 insertions(+), 659 deletions(-) create mode 100644 .params_2024-11-19_19-46-41.json create mode 100644 modules/nf-core/gunzip/tests/nextflow.config create mode 100644 modules/nf-core/multiqc/tests/nextflow.config diff --git a/.params_2024-11-19_19-46-41.json b/.params_2024-11-19_19-46-41.json new file mode 100644 index 00000000..af2a6937 --- /dev/null +++ b/.params_2024-11-19_19-46-41.json @@ -0,0 +1,57 @@ +{ + "input": "/Users/tc25/projects/blobtoolkit_tkc/assets/test/samplesheet_s3.csv", + "align": false, + "mask": false, + "fetchngs_samplesheet": false, + "busco_lineages": null, + "fasta": "https://tolit.cog.sanger.ac.uk/test-data/Meles_meles/assembly/release/mMelMel3.1_paternal_haplotype/GCA_922984935.2.subset.phiXspike.fasta.gz", + "accession": "GCA_922984935.2", + "taxon": "Meles meles", + "image_format": "png", + "taxdump": "https://ftp.ncbi.nlm.nih.gov/pub/taxonomy/new_taxdump/new_taxdump.tar.gz", + "busco": "https://tolit.cog.sanger.ac.uk/test-data/Meles_meles/resources/blobtoolkit.GCA_922984935.2.2023-08-03.tar.gz", + "lineage_tax_ids": "/Users/tc25/projects/blobtoolkit_tkc/assets/mapping_taxids-busco_dataset_name.2019-12-16.txt", + "blastp": "https://tolit.cog.sanger.ac.uk/test-data/Meles_meles/resources/mMelMel3.1.buscogenes.dmnd.tar.gz", + "blastx": "https://tolit.cog.sanger.ac.uk/test-data/Meles_meles/resources/mMelMel3.1.buscoregions.dmnd.tar.gz", + "blastn": "https://tolit.cog.sanger.ac.uk/test-data/Meles_meles/resources/nt_mMelMel3.1.tar.gz", + "skip_taxon_filtering": false, + "use_work_dir_as_temp": true, + "multiqc_config": null, + "multiqc_title": null, + "multiqc_logo": null, + "max_multiqc_email_size": "25.MB", + "multiqc_methods_description": null, + "outdir": "results", + "publish_dir_mode": "copy", + "email": null, + "email_on_fail": null, + "plaintext_email": false, + "monochrome_logs": false, + "hook_url": null, + "help": false, + "version": false, + "config_profile_name": "Test profile", + "config_profile_description": "Minimal aligned test dataset to check pipeline function", + "custom_config_version": "master", + "custom_config_base": "https://raw.githubusercontent.com/nf-core/configs/master", + "config_profile_contact": null, + "config_profile_url": null, + "max_memory": "6.GB", + "max_cpus": 2, + "max_time": "6.h", + "validationFailUnrecognisedParams": false, + "validation-fail-unrecognised-params": false, + "validationLenientMode": false, + "validation-lenient-mode": false, + "validationSchemaIgnoreParams": "genomes,igenomes_base", + "validation-schema-ignore-params": "genomes,igenomes_base", + "validationShowHiddenParams": false, + "validation-show-hidden-params": false, + "validate_params": true, + "validationSkipDuplicateCheck": false, + "validation-skip-duplicate-check": false, + "validationS3PathCheck": false, + "validation-S3Path-check": false, + "monochromeLogs": false, + "monochrome-logs": false +} \ No newline at end of file diff --git a/modules.json b/modules.json index 23b5b5d2..c87edcd2 100644 --- a/modules.json +++ b/modules.json @@ -19,12 +19,12 @@ }, "cat/cat": { "branch": "master", - "git_sha": "9437e6053dccf4aafa022bfd6e7e9de67e625af8", + "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", "installed_by": ["modules"] }, "custom/dumpsoftwareversions": { "branch": "master", - "git_sha": "de45447d060b8c8b98575bc637a4a575fd0638e1", + "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", "installed_by": ["modules"] }, "diamond/blastp": { @@ -47,43 +47,43 @@ }, "gunzip": { "branch": "master", - "git_sha": "3a5fef109d113b4997c9822198664ca5f2716208", + "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", "installed_by": ["modules"] }, "minimap2/align": { "branch": "master", - "git_sha": "2c2d1cf80866dbd6dd0ea5d61ddd59533a72d41e", + "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", "installed_by": ["modules"], "patch": "modules/nf-core/minimap2/align/minimap2-align.diff" }, "multiqc": { "branch": "master", - "git_sha": "b7ebe95761cd389603f9cc0e0dc384c0f663815a", + "git_sha": "cf17ca47590cc578dfb47db1c2a44ef86f89976d", "installed_by": ["modules"] }, "pigz/compress": { "branch": "master", - "git_sha": "0eab94fc1e48703c1b0a8704bd665f554905c39d", + "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", "installed_by": ["modules"] }, "samtools/flagstat": { "branch": "master", - "git_sha": "f4596fe0bdc096cf53ec4497e83defdb3a94ff62", + "git_sha": "b13f07be4c508d6ff6312d354d09f2493243e208", "installed_by": ["modules"] }, "samtools/index": { "branch": "master", - "git_sha": "f4596fe0bdc096cf53ec4497e83defdb3a94ff62", + "git_sha": "b13f07be4c508d6ff6312d354d09f2493243e208", "installed_by": ["modules"] }, "samtools/view": { "branch": "master", - "git_sha": "0bd7d2333a88483aa0476acea172e9f5f6dd83bb", + "git_sha": "669eb24fd82a9d3cb18ad0e73673ecb26827f683", "installed_by": ["modules"] }, "seqtk/subseq": { "branch": "master", - "git_sha": "7f88aae93c69586c0789322b77743ee0ef469502", + "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", "installed_by": ["modules"], "patch": "modules/nf-core/seqtk/subseq/seqtk-subseq.diff" }, @@ -94,12 +94,12 @@ }, "windowmasker/mkcounts": { "branch": "master", - "git_sha": "32cac29d4a92220965dace68a1fb0bb2e3547cac", + "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", "installed_by": ["modules"] }, "windowmasker/ustat": { "branch": "master", - "git_sha": "32cac29d4a92220965dace68a1fb0bb2e3547cac", + "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", "installed_by": ["modules"] } } diff --git a/modules/nf-core/cat/cat/environment.yml b/modules/nf-core/cat/cat/environment.yml index 17a04ef2..9b01c865 100644 --- a/modules/nf-core/cat/cat/environment.yml +++ b/modules/nf-core/cat/cat/environment.yml @@ -1,7 +1,5 @@ -name: cat_cat channels: - conda-forge - bioconda - - defaults dependencies: - conda-forge::pigz=2.3.4 diff --git a/modules/nf-core/cat/cat/main.nf b/modules/nf-core/cat/cat/main.nf index adbdbd7b..2862c64c 100644 --- a/modules/nf-core/cat/cat/main.nf +++ b/modules/nf-core/cat/cat/main.nf @@ -76,4 +76,3 @@ def getFileSuffix(filename) { def match = filename =~ /^.*?((\.\w{1,5})?(\.\w{1,5}\.gz$))/ return match ? match[0][1] : filename.substring(filename.lastIndexOf('.')) } - diff --git a/modules/nf-core/cat/cat/meta.yml b/modules/nf-core/cat/cat/meta.yml index 00a8db0b..81778a06 100644 --- a/modules/nf-core/cat/cat/meta.yml +++ b/modules/nf-core/cat/cat/meta.yml @@ -9,25 +9,32 @@ tools: description: Just concatenation documentation: https://man7.org/linux/man-pages/man1/cat.1.html licence: ["GPL-3.0-or-later"] + identifier: "" input: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - files_in: - type: file - description: List of compressed / uncompressed files - pattern: "*" + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - files_in: + type: file + description: List of compressed / uncompressed files + pattern: "*" output: - - versions: - type: file - description: File containing software versions - pattern: "versions.yml" - file_out: - type: file - description: Concatenated file. Will be gzipped if file_out ends with ".gz" - pattern: "${file_out}" + - meta: + type: file + description: Concatenated file. Will be gzipped if file_out ends with ".gz" + pattern: "${file_out}" + - ${prefix}: + type: file + description: Concatenated file. Will be gzipped if file_out ends with ".gz" + pattern: "${file_out}" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@erikrikarddaniel" - "@FriederikeHanssen" diff --git a/modules/nf-core/cat/cat/tests/main.nf.test b/modules/nf-core/cat/cat/tests/main.nf.test index fcee2d19..9cb16178 100644 --- a/modules/nf-core/cat/cat/tests/main.nf.test +++ b/modules/nf-core/cat/cat/tests/main.nf.test @@ -29,7 +29,8 @@ nextflow_process { then { assertAll( { assert !process.success }, - { assert process.stdout.toString().contains("The name of the input file can't be the same as for the output prefix") } + { assert process.stdout.toString().contains("The name of the input file can't be the same as for the output prefix") }, + { assert snapshot(process.out.versions).match() } ) } } @@ -83,8 +84,12 @@ nextflow_process { def lines = path(process.out.file_out.get(0).get(1)).linesGzip assertAll( { assert process.success }, - { assert snapshot(lines[0..5]).match("test_cat_zipped_zipped_lines") }, - { assert snapshot(lines.size()).match("test_cat_zipped_zipped_size")} + { assert snapshot( + lines[0..5], + lines.size(), + process.out.versions + ).match() + } ) } } @@ -142,8 +147,12 @@ nextflow_process { def lines = path(process.out.file_out.get(0).get(1)).linesGzip assertAll( { assert process.success }, - { assert snapshot(lines[0..5]).match("test_cat_unzipped_zipped_lines") }, - { assert snapshot(lines.size()).match("test_cat_unzipped_zipped_size")} + { assert snapshot( + lines[0..5], + lines.size(), + process.out.versions + ).match() + } ) } } @@ -170,8 +179,12 @@ nextflow_process { def lines = path(process.out.file_out.get(0).get(1)).linesGzip assertAll( { assert process.success }, - { assert snapshot(lines[0..5]).match("test_cat_one_file_unzipped_zipped_lines") }, - { assert snapshot(lines.size()).match("test_cat_one_file_unzipped_zipped_size")} + { assert snapshot( + lines[0..5], + lines.size(), + process.out.versions + ).match() + } ) } } diff --git a/modules/nf-core/cat/cat/tests/main.nf.test.snap b/modules/nf-core/cat/cat/tests/main.nf.test.snap index 423571ba..b7623ee6 100644 --- a/modules/nf-core/cat/cat/tests/main.nf.test.snap +++ b/modules/nf-core/cat/cat/tests/main.nf.test.snap @@ -1,10 +1,4 @@ { - "test_cat_unzipped_zipped_size": { - "content": [ - 375 - ], - "timestamp": "2023-10-16T14:33:08.049445686" - }, "test_cat_unzipped_unzipped": { "content": [ { @@ -34,6 +28,10 @@ ] } ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.3" + }, "timestamp": "2023-10-16T14:32:18.500464399" }, "test_cat_zipped_unzipped": { @@ -65,9 +63,13 @@ ] } ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.3" + }, "timestamp": "2023-10-16T14:32:49.642741302" }, - "test_cat_zipped_zipped_lines": { + "test_cat_zipped_zipped": { "content": [ [ "MT192765.1\tGenbank\ttranscript\t259\t29667\t.\t+\t.\tID=unknown_transcript_1;geneID=orf1ab;gene_name=orf1ab", @@ -76,11 +78,31 @@ "MT192765.1\tGenbank\tCDS\t13461\t21548\t.\t+\t0\tParent=unknown_transcript_1;exception=\"ribosomal slippage\";gbkey=CDS;gene=orf1ab;note=\"pp1ab;translated=by -1 ribosomal frameshift\";product=\"orf1ab polyprotein\";protein_id=QIK50426.1", "MT192765.1\tGenbank\tCDS\t21556\t25377\t.\t+\t0\tParent=unknown_transcript_1;gbkey=CDS;gene=S;note=\"structural protein\";product=\"surface glycoprotein\";protein_id=QIK50427.1", "MT192765.1\tGenbank\tgene\t21556\t25377\t.\t+\t.\tParent=unknown_transcript_1" + ], + 78, + [ + "versions.yml:md5,115ed6177ebcff24eb99d503fa5ef894" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:51:46.802978" + }, + "test_cat_name_conflict": { + "content": [ + [ + ] ], - "timestamp": "2023-10-16T14:32:33.629048645" + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:51:29.45394" }, - "test_cat_unzipped_zipped_lines": { + "test_cat_one_file_unzipped_zipped": { "content": [ [ ">MT192765.1 Severe acute respiratory syndrome coronavirus 2 isolate SARS-CoV-2/human/USA/PC00101P/2020, complete genome", @@ -89,11 +111,19 @@ "TAACTCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTTTGTCCGG", "GTGTGACCGAAAGGTAAGATGGAGAGCCTTGTCCCTGGTTTCAACGAGAAAACACACGTCCAACTCAGTTTGCCTGTTTT", "ACAGGTTCGCGACGTGCTCGTACGTGGCTTTGGAGACTCCGTGGAGGAGGTCTTATCAGAGGCACGTCAACATCTTAAAG" + ], + 374, + [ + "versions.yml:md5,115ed6177ebcff24eb99d503fa5ef894" ] ], - "timestamp": "2023-10-16T14:33:08.038830506" + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:52:02.774016" }, - "test_cat_one_file_unzipped_zipped_lines": { + "test_cat_unzipped_zipped": { "content": [ [ ">MT192765.1 Severe acute respiratory syndrome coronavirus 2 isolate SARS-CoV-2/human/USA/PC00101P/2020, complete genome", @@ -102,20 +132,16 @@ "TAACTCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTTTGTCCGG", "GTGTGACCGAAAGGTAAGATGGAGAGCCTTGTCCCTGGTTTCAACGAGAAAACACACGTCCAACTCAGTTTGCCTGTTTT", "ACAGGTTCGCGACGTGCTCGTACGTGGCTTTGGAGACTCCGTGGAGGAGGTCTTATCAGAGGCACGTCAACATCTTAAAG" + ], + 375, + [ + "versions.yml:md5,115ed6177ebcff24eb99d503fa5ef894" ] ], - "timestamp": "2023-10-16T14:33:21.39642399" - }, - "test_cat_zipped_zipped_size": { - "content": [ - 78 - ], - "timestamp": "2023-10-16T14:32:33.641869244" - }, - "test_cat_one_file_unzipped_zipped_size": { - "content": [ - 374 - ], - "timestamp": "2023-10-16T14:33:21.4094373" + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:51:57.581523" } } \ No newline at end of file diff --git a/modules/nf-core/custom/dumpsoftwareversions/environment.yml b/modules/nf-core/custom/dumpsoftwareversions/environment.yml index b48ced26..9d79af93 100644 --- a/modules/nf-core/custom/dumpsoftwareversions/environment.yml +++ b/modules/nf-core/custom/dumpsoftwareversions/environment.yml @@ -1,7 +1,5 @@ -name: custom_dumpsoftwareversions channels: - conda-forge - bioconda - - defaults dependencies: - bioconda::multiqc=1.20 diff --git a/modules/nf-core/custom/dumpsoftwareversions/meta.yml b/modules/nf-core/custom/dumpsoftwareversions/meta.yml index 5f15a5fd..dc1e412f 100644 --- a/modules/nf-core/custom/dumpsoftwareversions/meta.yml +++ b/modules/nf-core/custom/dumpsoftwareversions/meta.yml @@ -1,34 +1,40 @@ # yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/meta-schema.json name: custom_dumpsoftwareversions -description: Custom module used to dump software versions within the nf-core pipeline template +description: Custom module used to dump software versions within the nf-core pipeline + template keywords: - custom - dump - version tools: - custom: - description: Custom module used to dump software versions within the nf-core pipeline template + description: Custom module used to dump software versions within the nf-core pipeline + template homepage: https://github.com/nf-core/tools documentation: https://github.com/nf-core/tools licence: ["MIT"] + identifier: "" input: - - versions: - type: file - description: YML file containing software versions - pattern: "*.yml" + - - versions: + type: file + description: YML file containing software versions + pattern: "*.yml" output: - yml: - type: file - description: Standard YML file containing software versions - pattern: "software_versions.yml" + - software_versions.yml: + type: file + description: Standard YML file containing software versions + pattern: "software_versions.yml" - mqc_yml: - type: file - description: MultiQC custom content YML file containing software versions - pattern: "software_versions_mqc.yml" + - software_versions_mqc.yml: + type: file + description: MultiQC custom content YML file containing software versions + pattern: "software_versions_mqc.yml" - versions: - type: file - description: File containing software versions - pattern: "versions.yml" + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@drpatelh" - "@grst" diff --git a/modules/nf-core/custom/dumpsoftwareversions/templates/dumpsoftwareversions.py b/modules/nf-core/custom/dumpsoftwareversions/templates/dumpsoftwareversions.py index da033408..b83b32c4 100755 --- a/modules/nf-core/custom/dumpsoftwareversions/templates/dumpsoftwareversions.py +++ b/modules/nf-core/custom/dumpsoftwareversions/templates/dumpsoftwareversions.py @@ -3,11 +3,11 @@ """Provide functions to merge multiple versions.yml files.""" - -import yaml import platform from textwrap import dedent +import yaml + def _make_versions_html(versions): """Generate a tabular HTML output of all versions for MultiQC.""" diff --git a/modules/nf-core/gunzip/environment.yml b/modules/nf-core/gunzip/environment.yml index 25910b34..c7794856 100644 --- a/modules/nf-core/gunzip/environment.yml +++ b/modules/nf-core/gunzip/environment.yml @@ -1,7 +1,7 @@ -name: gunzip channels: - conda-forge - bioconda - - defaults dependencies: - - conda-forge::sed=4.7 + - conda-forge::grep=3.11 + - conda-forge::sed=4.8 + - conda-forge::tar=1.34 diff --git a/modules/nf-core/gunzip/main.nf b/modules/nf-core/gunzip/main.nf index 468a6f28..5e67e3b9 100644 --- a/modules/nf-core/gunzip/main.nf +++ b/modules/nf-core/gunzip/main.nf @@ -4,8 +4,8 @@ process GUNZIP { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/ubuntu:20.04' : - 'nf-core/ubuntu:20.04' }" + 'https://depot.galaxyproject.org/singularity/ubuntu:22.04' : + 'nf-core/ubuntu:22.04' }" input: tuple val(meta), path(archive) @@ -18,8 +18,11 @@ process GUNZIP { task.ext.when == null || task.ext.when script: - def args = task.ext.args ?: '' - gunzip = archive.toString() - '.gz' + def args = task.ext.args ?: '' + def extension = ( archive.toString() - '.gz' ).tokenize('.')[-1] + def name = archive.toString() - '.gz' - ".$extension" + def prefix = task.ext.prefix ?: name + gunzip = prefix + ".$extension" """ # Not calling gunzip itself because it creates files # with the original group ownership rather than the @@ -37,7 +40,11 @@ process GUNZIP { """ stub: - gunzip = archive.toString() - '.gz' + def args = task.ext.args ?: '' + def extension = ( archive.toString() - '.gz' ).tokenize('.')[-1] + def name = archive.toString() - '.gz' - ".$extension" + def prefix = task.ext.prefix ?: name + gunzip = prefix + ".$extension" """ touch $gunzip cat <<-END_VERSIONS > versions.yml diff --git a/modules/nf-core/gunzip/meta.yml b/modules/nf-core/gunzip/meta.yml index 231034f2..9066c035 100644 --- a/modules/nf-core/gunzip/meta.yml +++ b/modules/nf-core/gunzip/meta.yml @@ -10,25 +10,32 @@ tools: gzip is a file format and a software application used for file compression and decompression. documentation: https://www.gnu.org/software/gzip/manual/gzip.html licence: ["GPL-3.0-or-later"] + identifier: "" input: - - meta: - type: map - description: | - Optional groovy Map containing meta information - e.g. [ id:'test', single_end:false ] - - archive: - type: file - description: File to be compressed/uncompressed - pattern: "*.*" + - - meta: + type: map + description: | + Optional groovy Map containing meta information + e.g. [ id:'test', single_end:false ] + - archive: + type: file + description: File to be compressed/uncompressed + pattern: "*.*" output: - gunzip: - type: file - description: Compressed/uncompressed file - pattern: "*.*" + - meta: + type: file + description: Compressed/uncompressed file + pattern: "*.*" + - $gunzip: + type: file + description: Compressed/uncompressed file + pattern: "*.*" - versions: - type: file - description: File containing software versions - pattern: "versions.yml" + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@joseespinosa" - "@drpatelh" @@ -37,3 +44,4 @@ maintainers: - "@joseespinosa" - "@drpatelh" - "@jfy133" + - "@gallvp" diff --git a/modules/nf-core/gunzip/tests/main.nf.test b/modules/nf-core/gunzip/tests/main.nf.test index 6406008e..776211ad 100644 --- a/modules/nf-core/gunzip/tests/main.nf.test +++ b/modules/nf-core/gunzip/tests/main.nf.test @@ -33,4 +33,89 @@ nextflow_process { } + test("Should run without failures - prefix") { + + config './nextflow.config' + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = Channel.of([ + [ id: 'test' ], + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ] + ) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("Should run without failures - stub") { + + options '-stub' + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = Channel.of([ + [], + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ] + ) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("Should run without failures - prefix - stub") { + + options '-stub' + config './nextflow.config' + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = Channel.of([ + [ id: 'test' ], + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ] + ) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + } diff --git a/modules/nf-core/gunzip/tests/main.nf.test.snap b/modules/nf-core/gunzip/tests/main.nf.test.snap index 720fd9ff..069967e7 100644 --- a/modules/nf-core/gunzip/tests/main.nf.test.snap +++ b/modules/nf-core/gunzip/tests/main.nf.test.snap @@ -1,4 +1,70 @@ { + "Should run without failures - prefix - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.xyz.fastq:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,54376d32aca20e937a4ec26dac228e84" + ], + "gunzip": [ + [ + { + "id": "test" + }, + "test.xyz.fastq:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,54376d32aca20e937a4ec26dac228e84" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-25T11:35:10.861293" + }, + "Should run without failures - stub": { + "content": [ + { + "0": [ + [ + [ + + ], + "test_1.fastq:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,54376d32aca20e937a4ec26dac228e84" + ], + "gunzip": [ + [ + [ + + ], + "test_1.fastq:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,54376d32aca20e937a4ec26dac228e84" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-25T11:35:05.857145" + }, "Should run without failures": { "content": [ { @@ -26,6 +92,43 @@ ] } ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, "timestamp": "2023-10-17T15:35:37.690477896" + }, + "Should run without failures - prefix": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.xyz.fastq:md5,4161df271f9bfcd25d5845a1e220dbec" + ] + ], + "1": [ + "versions.yml:md5,54376d32aca20e937a4ec26dac228e84" + ], + "gunzip": [ + [ + { + "id": "test" + }, + "test.xyz.fastq:md5,4161df271f9bfcd25d5845a1e220dbec" + ] + ], + "versions": [ + "versions.yml:md5,54376d32aca20e937a4ec26dac228e84" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-25T11:33:32.921739" } } \ No newline at end of file diff --git a/modules/nf-core/gunzip/tests/nextflow.config b/modules/nf-core/gunzip/tests/nextflow.config new file mode 100644 index 00000000..dec77642 --- /dev/null +++ b/modules/nf-core/gunzip/tests/nextflow.config @@ -0,0 +1,5 @@ +process { + withName: GUNZIP { + ext.prefix = { "${meta.id}.xyz" } + } +} diff --git a/modules/nf-core/minimap2/align/environment.yml b/modules/nf-core/minimap2/align/environment.yml index cf6e775f..dc6476b7 100644 --- a/modules/nf-core/minimap2/align/environment.yml +++ b/modules/nf-core/minimap2/align/environment.yml @@ -1,9 +1,8 @@ -name: minimap2_align channels: - conda-forge - bioconda - - defaults + dependencies: - - bioconda::minimap2=2.24 - - bioconda::samtools=1.18 - - bioconda::htslib=1.18 + - bioconda::htslib=1.20 + - bioconda::minimap2=2.28 + - bioconda::samtools=1.20 diff --git a/modules/nf-core/minimap2/align/main.nf b/modules/nf-core/minimap2/align/main.nf index df7b1424..b0dc23bf 100644 --- a/modules/nf-core/minimap2/align/main.nf +++ b/modules/nf-core/minimap2/align/main.nf @@ -4,20 +4,22 @@ process MINIMAP2_ALIGN { // Note: the versions here need to match the versions used in the mulled container below and minimap2/index conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/mulled-v2-66534bcbb7031a148b13e2ad42583020b9cd25c4:365b17b986c1a60c1b82c6066a9345f38317b763-0' : - 'biocontainers/mulled-v2-66534bcbb7031a148b13e2ad42583020b9cd25c4:365b17b986c1a60c1b82c6066a9345f38317b763-0' }" + 'https://depot.galaxyproject.org/singularity/mulled-v2-66534bcbb7031a148b13e2ad42583020b9cd25c4:3161f532a5ea6f1dec9be5667c9efc2afdac6104-0' : + 'biocontainers/mulled-v2-66534bcbb7031a148b13e2ad42583020b9cd25c4:3161f532a5ea6f1dec9be5667c9efc2afdac6104-0' }" input: tuple val(meta), path(reads) tuple val(meta2), path(reference) val bam_format + val bam_index_extension val cigar_paf_format val cigar_bam output: - tuple val(meta), path("*.paf"), optional: true, emit: paf - tuple val(meta), path("*.bam"), optional: true, emit: bam - path "versions.yml" , emit: versions + tuple val(meta), path("*.paf") , optional: true, emit: paf + tuple val(meta), path("*.bam") , optional: true, emit: bam + tuple val(meta), path("*.bam.${bam_index_extension}"), optional: true, emit: index + path "versions.yml" , emit: versions when: task.ext.when == null || task.ext.when @@ -25,19 +27,25 @@ process MINIMAP2_ALIGN { script: def args = task.ext.args ?: '' def args2 = task.ext.args2 ?: '' + def args3 = task.ext.args3 ?: '' + def args4 = task.ext.args4 ?: '' def prefix = task.ext.prefix ?: "${meta.id}" - def bam_input = reads.getExtension() in ["bam", "cram"] ? "samtools fasta ${reads} | " : "" - if (bam_input && !reference) error "Fasta/q format is required for self-alignments" - def minimap_input = bam_input ? "-" : reads - def bam_output = bam_format ? "-a | samtools sort -@ ${task.cpus} -o ${prefix}.bam ${args2}" : "-o ${prefix}.paf" + def bam_index = bam_index_extension ? "${prefix}.bam##idx##${prefix}.bam.${bam_index_extension} --write-index" : "${prefix}.bam" + def bam_output = bam_format ? "-a | samtools sort -@ ${task.cpus-1} -o ${bam_index} ${args2}" : "-o ${prefix}.paf" def cigar_paf = cigar_paf_format && !bam_format ? "-c" : '' def set_cigar_bam = cigar_bam && bam_format ? "-L" : '' + def bam_input = "${reads.extension}".matches('sam|bam|cram') + def samtools_reset_fastq = bam_input ? "samtools reset --threads ${task.cpus-1} $args3 $reads | samtools fastq --threads ${task.cpus-1} $args4 |" : '' + def query = bam_input ? "-" : reads + def target = reference ?: (bam_input ? error("BAM input requires reference") : reads) + """ - ${bam_input} minimap2 \\ + $samtools_reset_fastq \\ + minimap2 \\ $args \\ -t $task.cpus \\ - ${reference ?: minimap_input} \\ - $minimap_input \\ + $target \\ + $query \\ $cigar_paf \\ $set_cigar_bam \\ $bam_output @@ -46,14 +54,20 @@ process MINIMAP2_ALIGN { cat <<-END_VERSIONS > versions.yml "${task.process}": minimap2: \$(minimap2 --version 2>&1) + samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//') END_VERSIONS """ stub: def prefix = task.ext.prefix ?: "${meta.id}" def output_file = bam_format ? "${prefix}.bam" : "${prefix}.paf" + def bam_index = bam_index_extension ? "touch ${prefix}.bam.${bam_index_extension}" : "" + def bam_input = "${reads.extension}".matches('sam|bam|cram') + def target = reference ?: (bam_input ? error("BAM input requires reference") : reads) + """ touch $output_file + ${bam_index} cat <<-END_VERSIONS > versions.yml "${task.process}": diff --git a/modules/nf-core/minimap2/align/meta.yml b/modules/nf-core/minimap2/align/meta.yml index 408522d5..a4cfc891 100644 --- a/modules/nf-core/minimap2/align/meta.yml +++ b/modules/nf-core/minimap2/align/meta.yml @@ -14,62 +14,86 @@ tools: homepage: https://github.com/lh3/minimap2 documentation: https://github.com/lh3/minimap2#uguide licence: ["MIT"] + identifier: "" input: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - reads: - type: file - description: | - List of input FASTA or FASTQ files of size 1 and 2 for single-end - and paired-end data, respectively. - - meta2: - type: map - description: | - Groovy Map containing reference information - e.g. [ id:'test_ref'] - - reference: - type: file - description: | - Reference database in FASTA format. - - bam_format: - type: boolean - description: Specify that output should be in BAM format - - cigar_paf_format: - type: boolean - description: Specify that output CIGAR should be in PAF format - - cigar_bam: - type: boolean - description: | - Write CIGAR with >65535 ops at the CG tag. This is recommended when - doing XYZ (https://github.com/lh3/minimap2#working-with-65535-cigar-operations) + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - reads: + type: file + description: | + List of input FASTA or FASTQ files of size 1 and 2 for single-end + and paired-end data, respectively. + - - meta2: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'test_ref'] + - reference: + type: file + description: | + Reference database in FASTA format. + - - bam_format: + type: boolean + description: Specify that output should be in BAM format + - - bam_index_extension: + type: string + description: BAM alignment index extension (e.g. "bai") + - - cigar_paf_format: + type: boolean + description: Specify that output CIGAR should be in PAF format + - - cigar_bam: + type: boolean + description: | + Write CIGAR with >65535 ops at the CG tag. This is recommended when + doing XYZ (https://github.com/lh3/minimap2#working-with-65535-cigar-operations) output: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - paf: - type: file - description: Alignment in PAF format - pattern: "*.paf" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.paf": + type: file + description: Alignment in PAF format + pattern: "*.paf" - bam: - type: file - description: Alignment in BAM format - pattern: "*.bam" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.bam": + type: file + description: Alignment in BAM format + pattern: "*.bam" + - index: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.bam.${bam_index_extension}": + type: file + description: BAM alignment index + pattern: "*.bam.*" - versions: - type: file - description: File containing software versions - pattern: "versions.yml" + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@heuermh" - "@sofstam" - "@sateeshperi" - "@jfy133" + - "@fellen31" maintainers: - "@heuermh" - "@sofstam" - "@sateeshperi" - "@jfy133" + - "@fellen31" diff --git a/modules/nf-core/minimap2/align/minimap2-align.diff b/modules/nf-core/minimap2/align/minimap2-align.diff index fa1b7d53..9dd291e7 100644 --- a/modules/nf-core/minimap2/align/minimap2-align.diff +++ b/modules/nf-core/minimap2/align/minimap2-align.diff @@ -4,31 +4,9 @@ Changes in module 'nf-core/minimap2/align' @@ -1,6 +1,5 @@ process MINIMAP2_ALIGN { tag "$meta.id" -- label 'process_medium' +- label 'process_high' // Note: the versions here need to match the versions used in the mulled container below and minimap2/index conda "${moduleDir}/environment.yml" -@@ -27,15 +26,18 @@ - def args = task.ext.args ?: '' - def args2 = task.ext.args2 ?: '' - def prefix = task.ext.prefix ?: "${meta.id}" -+ def bam_input = reads.getExtension() in ["bam", "cram"] ? "samtools fasta ${reads} | " : "" -+ if (bam_input && !reference) error "Fasta/q format is required for self-alignments" -+ def minimap_input = bam_input ? "-" : reads - def bam_output = bam_format ? "-a | samtools sort -@ ${task.cpus} -o ${prefix}.bam ${args2}" : "-o ${prefix}.paf" - def cigar_paf = cigar_paf_format && !bam_format ? "-c" : '' - def set_cigar_bam = cigar_bam && bam_format ? "-L" : '' - """ -- minimap2 \\ -+ ${bam_input} minimap2 \\ - $args \\ - -t $task.cpus \\ -- ${reference ?: reads} \\ -- $reads \\ -+ ${reference ?: minimap_input} \\ -+ $minimap_input \\ - $cigar_paf \\ - $set_cigar_bam \\ - $bam_output ************************************************************ diff --git a/modules/nf-core/minimap2/align/tests/main.nf.test b/modules/nf-core/minimap2/align/tests/main.nf.test index 4d77e0d9..4072c171 100644 --- a/modules/nf-core/minimap2/align/tests/main.nf.test +++ b/modules/nf-core/minimap2/align/tests/main.nf.test @@ -9,22 +9,23 @@ nextflow_process { tag "minimap2" tag "minimap2/align" - test("sarscov2 - fastq, fasta, true, false, false") { + test("sarscov2 - fastq, fasta, true, [], false, false") { when { process { """ input[0] = [ [ id:'test', single_end:true ], // meta map - file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] input[1] = [ [ id:'test_ref' ], // meta map - file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) ] input[2] = true - input[3] = false + input[3] = [] input[4] = false + input[5] = false """ } } @@ -33,7 +34,43 @@ nextflow_process { assertAll( { assert process.success }, { assert snapshot( - file(process.out.bam[0][1]).name, + bam(process.out.bam[0][1]).getHeader(), + bam(process.out.bam[0][1]).getReadsMD5(), + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - fastq, fasta, true, 'bai', false, false") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ] + input[1] = [ + [ id:'test_ref' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + input[2] = true + input[3] = 'bai' + input[4] = false + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + bam(process.out.bam[0][1]).getHeader(), + bam(process.out.bam[0][1]).getReadsMD5(), + file(process.out.index[0][1]).name, process.out.versions ).match() } ) @@ -49,17 +86,18 @@ nextflow_process { input[0] = [ [ id:'test', single_end:false ], // meta map [ - file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), - file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] ] input[1] = [ [ id:'test_ref' ], // meta map - file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) ] input[2] = true - input[3] = false + input[3] = [] input[4] = false + input[5] = false """ } } @@ -68,7 +106,8 @@ nextflow_process { assertAll( { assert process.success }, { assert snapshot( - file(process.out.bam[0][1]).name, + bam(process.out.bam[0][1]).getHeader(), + bam(process.out.bam[0][1]).getReadsMD5(), process.out.versions ).match() } ) @@ -83,15 +122,16 @@ nextflow_process { """ input[0] = [ [ id:'test', single_end:true ], // meta map - file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), ] input[1] = [ [ id:'test_ref' ], // meta map [] ] input[2] = true - input[3] = false + input[3] = [] input[4] = false + input[5] = false """ } } @@ -100,7 +140,8 @@ nextflow_process { assertAll( { assert process.success }, { assert snapshot( - file(process.out.bam[0][1]).name, + bam(process.out.bam[0][1]).getHeader(), + bam(process.out.bam[0][1]).getReadsMD5(), process.out.versions ).match() } ) @@ -108,24 +149,57 @@ nextflow_process { } - test("sarscov2 - fastq, fasta, true, false, false - stub") { + test("sarscov2 - bam, fasta, true, [], false, false") { - options "-stub" + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test3.single_end.markduplicates.sorted.bam', checkIfExists: true) + ] + input[1] = [ + [ id:'test_ref' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + input[2] = true + input[3] = [] + input[4] = false + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + bam(process.out.bam[0][1]).getHeader(), + bam(process.out.bam[0][1]).getReadsMD5(), + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - bam, fasta, true, 'bai', false, false") { when { process { """ input[0] = [ [ id:'test', single_end:true ], // meta map - file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test3.single_end.markduplicates.sorted.bam', checkIfExists: true) ] input[1] = [ [ id:'test_ref' ], // meta map - file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) ] input[2] = true - input[3] = false + input[3] = 'bai' input[4] = false + input[5] = false """ } } @@ -134,7 +208,9 @@ nextflow_process { assertAll( { assert process.success }, { assert snapshot( - file(process.out.bam[0][1]).name, + bam(process.out.bam[0][1]).getHeader(), + bam(process.out.bam[0][1]).getReadsMD5(), + file(process.out.index[0][1]).name, process.out.versions ).match() } ) @@ -142,7 +218,36 @@ nextflow_process { } - test("sarscov2 - fastq, fasta, false, false, false - stub") { + test("sarscov2 - bam, [], true, false, false") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test3.single_end.markduplicates.sorted.bam', checkIfExists: true) + ] + input[1] = [ + [ id:'test_ref' ], // meta map + [] + ] + input[2] = true + input[3] = [] + input[4] = false + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.failed } + ) + } + + } + + test("sarscov2 - fastq, fasta, true, [], false, false - stub") { options "-stub" @@ -151,15 +256,80 @@ nextflow_process { """ input[0] = [ [ id:'test', single_end:true ], // meta map - file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] input[1] = [ [ id:'test_ref' ], // meta map - file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + input[2] = true + input[3] = [] + input[4] = false + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("sarscov2 - fastq, fasta, true, 'bai', false, false - stub") { + + options "-stub" + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ] + input[1] = [ + [ id:'test_ref' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + input[2] = true + input[3] = 'bai' + input[4] = false + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("sarscov2 - fastq, fasta, false, [], false, false - stub") { + + options "-stub" + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ] + input[1] = [ + [ id:'test_ref' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) ] input[2] = false - input[3] = false + input[3] = [] input[4] = false + input[5] = false """ } } @@ -167,13 +337,105 @@ nextflow_process { then { assertAll( { assert process.success }, - { assert snapshot( - file(process.out.paf[0][1]).name, - process.out.versions - ).match() } + { assert snapshot(process.out).match() } + ) + } + + } + + test("sarscov2 - bam, fasta, true, [], false, false - stub") { + + options "-stub" + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test3.single_end.markduplicates.sorted.bam', checkIfExists: true) + ] + input[1] = [ + [ id:'test_ref' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + input[2] = true + input[3] = [] + input[4] = false + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("sarscov2 - bam, fasta, true, 'bai', false, false - stub") { + + options "-stub" + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test3.single_end.markduplicates.sorted.bam', checkIfExists: true) + ] + input[1] = [ + [ id:'test_ref' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + input[2] = true + input[3] = 'bai' + input[4] = false + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("sarscov2 - bam, [], true, false, false - stub") { + + options "-stub" + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test3.single_end.markduplicates.sorted.bam', checkIfExists: true) + ] + input[1] = [ + [ id:'test_ref' ], // meta map + [] + ] + input[2] = true + input[3] = [] + input[4] = false + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.failed } ) } } -} +} \ No newline at end of file diff --git a/modules/nf-core/minimap2/align/tests/main.nf.test.snap b/modules/nf-core/minimap2/align/tests/main.nf.test.snap index ec99d13e..12264a85 100644 --- a/modules/nf-core/minimap2/align/tests/main.nf.test.snap +++ b/modules/nf-core/minimap2/align/tests/main.nf.test.snap @@ -1,67 +1,476 @@ { - "sarscov2 - fastq, fasta, true, false, false": { + "sarscov2 - bam, fasta, true, 'bai', false, false": { "content": [ - "test.bam", [ - "versions.yml:md5,9e9eeae0002d466d580a9d6e0d003eb1" + "@HD\tVN:1.6\tSO:coordinate", + "@SQ\tSN:MT192765.1\tLN:29829", + "@PG\tID:minimap2\tPN:minimap2\tVN:2.28-r1209\tCL:minimap2 -t 2 -a genome.fasta -", + "@PG\tID:samtools\tPN:samtools\tPP:minimap2\tVN:1.20\tCL:samtools sort -@ 1 -o test.bam##idx##test.bam.bai --write-index" + ], + "5d426b9a5f5b2c54f1d7f1e4c238ae94", + "test.bam.bai", + [ + "versions.yml:md5,3548eeba9066efbf8d78ea99f8d813fd" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-25T09:03:00.827260362" + }, + "sarscov2 - bam, fasta, true, 'bai', false, false - stub": { + "content": [ + { + "0": [ + + ], + "1": [ + [ + { + "id": "test", + "single_end": true + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": true + }, + "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + "versions.yml:md5,98b8f5f36aa54b82210094f0b0d11938" + ], + "bam": [ + [ + { + "id": "test", + "single_end": true + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "index": [ + [ + { + "id": "test", + "single_end": true + }, + "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "paf": [ + + ], + "versions": [ + "versions.yml:md5,98b8f5f36aa54b82210094f0b0d11938" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-23T11:21:37.92353539" + }, + "sarscov2 - fastq, fasta, true, 'bai', false, false - stub": { + "content": [ + { + "0": [ + + ], + "1": [ + [ + { + "id": "test", + "single_end": true + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": true + }, + "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + "versions.yml:md5,98b8f5f36aa54b82210094f0b0d11938" + ], + "bam": [ + [ + { + "id": "test", + "single_end": true + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "index": [ + [ + { + "id": "test", + "single_end": true + }, + "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "paf": [ + + ], + "versions": [ + "versions.yml:md5,98b8f5f36aa54b82210094f0b0d11938" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-03T11:29:44.669021368" + }, + "sarscov2 - fastq, fasta, false, [], false, false - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.paf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + + ], + "2": [ + + ], + "3": [ + "versions.yml:md5,98b8f5f36aa54b82210094f0b0d11938" + ], + "bam": [ + + ], + "index": [ + + ], + "paf": [ + [ + { + "id": "test", + "single_end": true + }, + "test.paf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,98b8f5f36aa54b82210094f0b0d11938" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-03T11:15:52.738781039" + }, + "sarscov2 - fastq, fasta, true, [], false, false - stub": { + "content": [ + { + "0": [ + + ], + "1": [ + [ + { + "id": "test", + "single_end": true + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + + ], + "3": [ + "versions.yml:md5,98b8f5f36aa54b82210094f0b0d11938" + ], + "bam": [ + [ + { + "id": "test", + "single_end": true + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "index": [ + + ], + "paf": [ + + ], + "versions": [ + "versions.yml:md5,98b8f5f36aa54b82210094f0b0d11938" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-03T11:15:23.033808223" + }, + "sarscov2 - [fastq1, fastq2], fasta, true, false, false": { + "content": [ + [ + "@HD\tVN:1.6\tSO:coordinate", + "@SQ\tSN:MT192765.1\tLN:29829", + "@PG\tID:minimap2\tPN:minimap2\tVN:2.28-r1209\tCL:minimap2 -t 2 -a genome.fasta test_1.fastq.gz test_2.fastq.gz", + "@PG\tID:samtools\tPN:samtools\tPP:minimap2\tVN:1.20\tCL:samtools sort -@ 1 -o test.bam" + ], + "1bc392244f228bf52cf0b5a8f6a654c9", + [ + "versions.yml:md5,3548eeba9066efbf8d78ea99f8d813fd" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.0" + "nextflow": "24.04.2" }, - "timestamp": "2023-12-04T12:07:06.01315354" + "timestamp": "2024-07-23T11:18:18.964586894" }, - "sarscov2 - fastq, fasta, true, false, false - stub": { + "sarscov2 - fastq, fasta, true, [], false, false": { "content": [ - "test.bam", [ - "versions.yml:md5,9e9eeae0002d466d580a9d6e0d003eb1" + "@HD\tVN:1.6\tSO:coordinate", + "@SQ\tSN:MT192765.1\tLN:29829", + "@PG\tID:minimap2\tPN:minimap2\tVN:2.28-r1209\tCL:minimap2 -t 2 -a genome.fasta test_1.fastq.gz", + "@PG\tID:samtools\tPN:samtools\tPP:minimap2\tVN:1.20\tCL:samtools sort -@ 1 -o test.bam" + ], + "f194745c0ccfcb2a9c0aee094a08750", + [ + "versions.yml:md5,3548eeba9066efbf8d78ea99f8d813fd" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.0" + "nextflow": "24.04.2" }, - "timestamp": "2023-12-04T12:07:24.487175659" + "timestamp": "2024-07-23T11:17:48.667488325" }, - "sarscov2 - fastq, fasta, false, false, false - stub": { + "sarscov2 - fastq, fasta, true, 'bai', false, false": { "content": [ - "test.paf", [ - "versions.yml:md5,9e9eeae0002d466d580a9d6e0d003eb1" + "@HD\tVN:1.6\tSO:coordinate", + "@SQ\tSN:MT192765.1\tLN:29829", + "@PG\tID:minimap2\tPN:minimap2\tVN:2.28-r1209\tCL:minimap2 -t 2 -a genome.fasta test_1.fastq.gz", + "@PG\tID:samtools\tPN:samtools\tPP:minimap2\tVN:1.20\tCL:samtools sort -@ 1 -o test.bam##idx##test.bam.bai --write-index" + ], + "f194745c0ccfcb2a9c0aee094a08750", + "test.bam.bai", + [ + "versions.yml:md5,3548eeba9066efbf8d78ea99f8d813fd" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.0" + "nextflow": "24.04.2" }, - "timestamp": "2024-03-01T11:06:54.090105" + "timestamp": "2024-07-23T11:18:02.517416733" }, - "sarscov2 - [fastq1, fastq2], fasta, true, false, false": { + "sarscov2 - bam, fasta, true, [], false, false": { "content": [ - "test.bam", [ - "versions.yml:md5,9e9eeae0002d466d580a9d6e0d003eb1" + "@HD\tVN:1.6\tSO:coordinate", + "@SQ\tSN:MT192765.1\tLN:29829", + "@PG\tID:minimap2\tPN:minimap2\tVN:2.28-r1209\tCL:minimap2 -t 2 -a genome.fasta -", + "@PG\tID:samtools\tPN:samtools\tPP:minimap2\tVN:1.20\tCL:samtools sort -@ 1 -o test.bam" + ], + "5d426b9a5f5b2c54f1d7f1e4c238ae94", + [ + "versions.yml:md5,3548eeba9066efbf8d78ea99f8d813fd" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.0" + "nextflow": "24.04.2" }, - "timestamp": "2023-12-04T12:07:12.50816279" + "timestamp": "2024-07-25T09:02:49.64829488" + }, + "sarscov2 - bam, fasta, true, [], false, false - stub": { + "content": [ + { + "0": [ + + ], + "1": [ + [ + { + "id": "test", + "single_end": true + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + + ], + "3": [ + "versions.yml:md5,98b8f5f36aa54b82210094f0b0d11938" + ], + "bam": [ + [ + { + "id": "test", + "single_end": true + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "index": [ + + ], + "paf": [ + + ], + "versions": [ + "versions.yml:md5,98b8f5f36aa54b82210094f0b0d11938" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-23T11:21:22.162291795" }, "sarscov2 - fastq, [], true, false, false": { "content": [ - "test.bam", [ - "versions.yml:md5,9e9eeae0002d466d580a9d6e0d003eb1" + "@HD\tVN:1.6\tSO:coordinate", + "@SQ\tSN:ERR5069949.2151832\tLN:150", + "@SQ\tSN:ERR5069949.576388\tLN:77", + "@SQ\tSN:ERR5069949.501486\tLN:146", + "@SQ\tSN:ERR5069949.1331889\tLN:132", + "@SQ\tSN:ERR5069949.2161340\tLN:80", + "@SQ\tSN:ERR5069949.973930\tLN:79", + "@SQ\tSN:ERR5069949.2417063\tLN:150", + "@SQ\tSN:ERR5069949.376959\tLN:151", + "@SQ\tSN:ERR5069949.1088785\tLN:149", + "@SQ\tSN:ERR5069949.1066259\tLN:147", + "@SQ\tSN:ERR5069949.2832676\tLN:139", + "@SQ\tSN:ERR5069949.2953930\tLN:151", + "@SQ\tSN:ERR5069949.324865\tLN:151", + "@SQ\tSN:ERR5069949.2185111\tLN:150", + "@SQ\tSN:ERR5069949.937422\tLN:151", + "@SQ\tSN:ERR5069949.2431709\tLN:150", + "@SQ\tSN:ERR5069949.1246538\tLN:148", + "@SQ\tSN:ERR5069949.1189252\tLN:98", + "@SQ\tSN:ERR5069949.2216307\tLN:147", + "@SQ\tSN:ERR5069949.3273002\tLN:148", + "@SQ\tSN:ERR5069949.3277445\tLN:151", + "@SQ\tSN:ERR5069949.3022231\tLN:147", + "@SQ\tSN:ERR5069949.184542\tLN:151", + "@SQ\tSN:ERR5069949.540529\tLN:149", + "@SQ\tSN:ERR5069949.686090\tLN:150", + "@SQ\tSN:ERR5069949.2787556\tLN:106", + "@SQ\tSN:ERR5069949.2650879\tLN:150", + "@SQ\tSN:ERR5069949.2064910\tLN:149", + "@SQ\tSN:ERR5069949.2328704\tLN:150", + "@SQ\tSN:ERR5069949.1067032\tLN:150", + "@SQ\tSN:ERR5069949.3338256\tLN:151", + "@SQ\tSN:ERR5069949.1412839\tLN:147", + "@SQ\tSN:ERR5069949.1538968\tLN:150", + "@SQ\tSN:ERR5069949.147998\tLN:94", + "@SQ\tSN:ERR5069949.366975\tLN:106", + "@SQ\tSN:ERR5069949.1372331\tLN:151", + "@SQ\tSN:ERR5069949.1709367\tLN:129", + "@SQ\tSN:ERR5069949.2388984\tLN:150", + "@SQ\tSN:ERR5069949.1132353\tLN:150", + "@SQ\tSN:ERR5069949.1151736\tLN:151", + "@SQ\tSN:ERR5069949.479807\tLN:150", + "@SQ\tSN:ERR5069949.2176303\tLN:151", + "@SQ\tSN:ERR5069949.2772897\tLN:151", + "@SQ\tSN:ERR5069949.1020777\tLN:122", + "@SQ\tSN:ERR5069949.465452\tLN:151", + "@SQ\tSN:ERR5069949.1704586\tLN:149", + "@SQ\tSN:ERR5069949.1258508\tLN:151", + "@SQ\tSN:ERR5069949.986441\tLN:119", + "@SQ\tSN:ERR5069949.2674295\tLN:148", + "@SQ\tSN:ERR5069949.885966\tLN:79", + "@SQ\tSN:ERR5069949.2342766\tLN:151", + "@SQ\tSN:ERR5069949.3122970\tLN:127", + "@SQ\tSN:ERR5069949.3279513\tLN:72", + "@SQ\tSN:ERR5069949.309410\tLN:151", + "@SQ\tSN:ERR5069949.532979\tLN:149", + "@SQ\tSN:ERR5069949.2888794\tLN:151", + "@SQ\tSN:ERR5069949.2205229\tLN:150", + "@SQ\tSN:ERR5069949.786562\tLN:151", + "@SQ\tSN:ERR5069949.919671\tLN:151", + "@SQ\tSN:ERR5069949.1328186\tLN:151", + "@SQ\tSN:ERR5069949.870926\tLN:149", + "@SQ\tSN:ERR5069949.2257580\tLN:151", + "@SQ\tSN:ERR5069949.3249622\tLN:77", + "@SQ\tSN:ERR5069949.611123\tLN:125", + "@SQ\tSN:ERR5069949.651338\tLN:142", + "@SQ\tSN:ERR5069949.169513\tLN:92", + "@SQ\tSN:ERR5069949.155944\tLN:150", + "@SQ\tSN:ERR5069949.2033605\tLN:150", + "@SQ\tSN:ERR5069949.2730382\tLN:142", + "@SQ\tSN:ERR5069949.2125592\tLN:150", + "@SQ\tSN:ERR5069949.1062611\tLN:151", + "@SQ\tSN:ERR5069949.1778133\tLN:151", + "@SQ\tSN:ERR5069949.3057020\tLN:95", + "@SQ\tSN:ERR5069949.2972968\tLN:141", + "@SQ\tSN:ERR5069949.2734474\tLN:149", + "@SQ\tSN:ERR5069949.856527\tLN:151", + "@SQ\tSN:ERR5069949.2098070\tLN:151", + "@SQ\tSN:ERR5069949.1552198\tLN:150", + "@SQ\tSN:ERR5069949.2385514\tLN:150", + "@SQ\tSN:ERR5069949.2270078\tLN:151", + "@SQ\tSN:ERR5069949.114870\tLN:150", + "@SQ\tSN:ERR5069949.2668880\tLN:147", + "@SQ\tSN:ERR5069949.257821\tLN:139", + "@SQ\tSN:ERR5069949.2243023\tLN:150", + "@SQ\tSN:ERR5069949.2605155\tLN:146", + "@SQ\tSN:ERR5069949.1340552\tLN:151", + "@SQ\tSN:ERR5069949.1561137\tLN:150", + "@SQ\tSN:ERR5069949.2361683\tLN:149", + "@SQ\tSN:ERR5069949.2521353\tLN:150", + "@SQ\tSN:ERR5069949.1261808\tLN:149", + "@SQ\tSN:ERR5069949.2734873\tLN:98", + "@SQ\tSN:ERR5069949.3017828\tLN:107", + "@SQ\tSN:ERR5069949.573706\tLN:150", + "@SQ\tSN:ERR5069949.1980512\tLN:151", + "@SQ\tSN:ERR5069949.1014693\tLN:150", + "@SQ\tSN:ERR5069949.3184655\tLN:150", + "@SQ\tSN:ERR5069949.29668\tLN:89", + "@SQ\tSN:ERR5069949.3258358\tLN:151", + "@SQ\tSN:ERR5069949.1476386\tLN:151", + "@SQ\tSN:ERR5069949.2415814\tLN:150", + "@PG\tID:minimap2\tPN:minimap2\tVN:2.28-r1209\tCL:minimap2 -t 2 -a test_1.fastq.gz test_1.fastq.gz", + "@PG\tID:samtools\tPN:samtools\tPP:minimap2\tVN:1.20\tCL:samtools sort -@ 1 -o test.bam" + ], + "16c1c651f8ec67383bcdee3c55aed94f", + [ + "versions.yml:md5,3548eeba9066efbf8d78ea99f8d813fd" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.0" + "nextflow": "24.04.2" }, - "timestamp": "2023-12-04T12:07:18.414974788" + "timestamp": "2024-07-23T11:18:34.246998277" } } \ No newline at end of file diff --git a/modules/nf-core/multiqc/environment.yml b/modules/nf-core/multiqc/environment.yml index ca39fb67..6f5b867b 100644 --- a/modules/nf-core/multiqc/environment.yml +++ b/modules/nf-core/multiqc/environment.yml @@ -1,7 +1,5 @@ -name: multiqc channels: - conda-forge - bioconda - - defaults dependencies: - - bioconda::multiqc=1.21 + - bioconda::multiqc=1.25.1 diff --git a/modules/nf-core/multiqc/main.nf b/modules/nf-core/multiqc/main.nf index 47ac352f..cc0643e1 100644 --- a/modules/nf-core/multiqc/main.nf +++ b/modules/nf-core/multiqc/main.nf @@ -3,14 +3,16 @@ process MULTIQC { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/multiqc:1.21--pyhdfd78af_0' : - 'biocontainers/multiqc:1.21--pyhdfd78af_0' }" + 'https://depot.galaxyproject.org/singularity/multiqc:1.25.1--pyhdfd78af_0' : + 'biocontainers/multiqc:1.25.1--pyhdfd78af_0' }" input: path multiqc_files, stageAs: "?/*" path(multiqc_config) path(extra_multiqc_config) path(multiqc_logo) + path(replace_names) + path(sample_names) output: path "*multiqc_report.html", emit: report @@ -23,16 +25,22 @@ process MULTIQC { script: def args = task.ext.args ?: '' + def prefix = task.ext.prefix ? "--filename ${task.ext.prefix}.html" : '' def config = multiqc_config ? "--config $multiqc_config" : '' def extra_config = extra_multiqc_config ? "--config $extra_multiqc_config" : '' - def logo = multiqc_logo ? /--cl-config 'custom_logo: "${multiqc_logo}"'/ : '' + def logo = multiqc_logo ? "--cl-config 'custom_logo: \"${multiqc_logo}\"'" : '' + def replace = replace_names ? "--replace-names ${replace_names}" : '' + def samples = sample_names ? "--sample-names ${sample_names}" : '' """ multiqc \\ --force \\ $args \\ $config \\ + $prefix \\ $extra_config \\ $logo \\ + $replace \\ + $samples \\ . cat <<-END_VERSIONS > versions.yml @@ -44,7 +52,7 @@ process MULTIQC { stub: """ mkdir multiqc_data - touch multiqc_plots + mkdir multiqc_plots touch multiqc_report.html cat <<-END_VERSIONS > versions.yml diff --git a/modules/nf-core/multiqc/meta.yml b/modules/nf-core/multiqc/meta.yml index 45a9bc35..b16c1879 100644 --- a/modules/nf-core/multiqc/meta.yml +++ b/modules/nf-core/multiqc/meta.yml @@ -1,5 +1,6 @@ name: multiqc -description: Aggregate results from bioinformatics analyses across many samples into a single report +description: Aggregate results from bioinformatics analyses across many samples into + a single report keywords: - QC - bioinformatics tools @@ -12,40 +13,59 @@ tools: homepage: https://multiqc.info/ documentation: https://multiqc.info/docs/ licence: ["GPL-3.0-or-later"] + identifier: biotools:multiqc input: - - multiqc_files: - type: file - description: | - List of reports / files recognised by MultiQC, for example the html and zip output of FastQC - - multiqc_config: - type: file - description: Optional config yml for MultiQC - pattern: "*.{yml,yaml}" - - extra_multiqc_config: - type: file - description: Second optional config yml for MultiQC. Will override common sections in multiqc_config. - pattern: "*.{yml,yaml}" - - multiqc_logo: - type: file - description: Optional logo file for MultiQC - pattern: "*.{png}" + - - multiqc_files: + type: file + description: | + List of reports / files recognised by MultiQC, for example the html and zip output of FastQC + - - multiqc_config: + type: file + description: Optional config yml for MultiQC + pattern: "*.{yml,yaml}" + - - extra_multiqc_config: + type: file + description: Second optional config yml for MultiQC. Will override common sections + in multiqc_config. + pattern: "*.{yml,yaml}" + - - multiqc_logo: + type: file + description: Optional logo file for MultiQC + pattern: "*.{png}" + - - replace_names: + type: file + description: | + Optional two-column sample renaming file. First column a set of + patterns, second column a set of corresponding replacements. Passed via + MultiQC's `--replace-names` option. + pattern: "*.{tsv}" + - - sample_names: + type: file + description: | + Optional TSV file with headers, passed to the MultiQC --sample_names + argument. + pattern: "*.{tsv}" output: - report: - type: file - description: MultiQC report file - pattern: "multiqc_report.html" + - "*multiqc_report.html": + type: file + description: MultiQC report file + pattern: "multiqc_report.html" - data: - type: directory - description: MultiQC data dir - pattern: "multiqc_data" + - "*_data": + type: directory + description: MultiQC data dir + pattern: "multiqc_data" - plots: - type: file - description: Plots created by MultiQC - pattern: "*_data" + - "*_plots": + type: file + description: Plots created by MultiQC + pattern: "*_data" - versions: - type: file - description: File containing software versions - pattern: "versions.yml" + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@abhi18av" - "@bunop" diff --git a/modules/nf-core/multiqc/tests/main.nf.test b/modules/nf-core/multiqc/tests/main.nf.test index f1c4242e..33316a7d 100644 --- a/modules/nf-core/multiqc/tests/main.nf.test +++ b/modules/nf-core/multiqc/tests/main.nf.test @@ -8,6 +8,8 @@ nextflow_process { tag "modules_nfcore" tag "multiqc" + config "./nextflow.config" + test("sarscov2 single-end [fastqc]") { when { @@ -17,6 +19,8 @@ nextflow_process { input[1] = [] input[2] = [] input[3] = [] + input[4] = [] + input[5] = [] """ } } @@ -41,6 +45,8 @@ nextflow_process { input[1] = Channel.of(file("https://github.com/nf-core/tools/raw/dev/nf_core/pipeline-template/assets/multiqc_config.yml", checkIfExists: true)) input[2] = [] input[3] = [] + input[4] = [] + input[5] = [] """ } } @@ -66,6 +72,8 @@ nextflow_process { input[1] = [] input[2] = [] input[3] = [] + input[4] = [] + input[5] = [] """ } } diff --git a/modules/nf-core/multiqc/tests/main.nf.test.snap b/modules/nf-core/multiqc/tests/main.nf.test.snap index bfebd802..2fcbb5ff 100644 --- a/modules/nf-core/multiqc/tests/main.nf.test.snap +++ b/modules/nf-core/multiqc/tests/main.nf.test.snap @@ -2,14 +2,14 @@ "multiqc_versions_single": { "content": [ [ - "versions.yml:md5,21f35ee29416b9b3073c28733efe4b7d" + "versions.yml:md5,41f391dcedce7f93ca188f3a3ffa0916" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.4" }, - "timestamp": "2024-02-29T08:48:55.657331" + "timestamp": "2024-10-02T17:51:46.317523" }, "multiqc_stub": { "content": [ @@ -17,25 +17,25 @@ "multiqc_report.html", "multiqc_data", "multiqc_plots", - "versions.yml:md5,21f35ee29416b9b3073c28733efe4b7d" + "versions.yml:md5,41f391dcedce7f93ca188f3a3ffa0916" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.4" }, - "timestamp": "2024-02-29T08:49:49.071937" + "timestamp": "2024-10-02T17:52:20.680978" }, "multiqc_versions_config": { "content": [ [ - "versions.yml:md5,21f35ee29416b9b3073c28733efe4b7d" + "versions.yml:md5,41f391dcedce7f93ca188f3a3ffa0916" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.4" }, - "timestamp": "2024-02-29T08:49:25.457567" + "timestamp": "2024-10-02T17:52:09.185842" } } \ No newline at end of file diff --git a/modules/nf-core/multiqc/tests/nextflow.config b/modules/nf-core/multiqc/tests/nextflow.config new file mode 100644 index 00000000..c537a6a3 --- /dev/null +++ b/modules/nf-core/multiqc/tests/nextflow.config @@ -0,0 +1,5 @@ +process { + withName: 'MULTIQC' { + ext.prefix = null + } +} diff --git a/modules/nf-core/pigz/compress/environment.yml b/modules/nf-core/pigz/compress/environment.yml index 7551d187..5016d226 100644 --- a/modules/nf-core/pigz/compress/environment.yml +++ b/modules/nf-core/pigz/compress/environment.yml @@ -1,9 +1,7 @@ --- # yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json -name: "pigz_compress" channels: - conda-forge - bioconda - - defaults dependencies: - "pigz=2.8" diff --git a/modules/nf-core/pigz/compress/meta.yml b/modules/nf-core/pigz/compress/meta.yml index 42efd735..0966e651 100644 --- a/modules/nf-core/pigz/compress/meta.yml +++ b/modules/nf-core/pigz/compress/meta.yml @@ -1,4 +1,3 @@ ---- # yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/meta-schema.json name: "pigz_compress" description: Compresses files with pigz. @@ -12,35 +11,33 @@ tools: homepage: "https://zlib.net/pigz/" documentation: "https://zlib.net/pigz/pigz.pdf" + identifier: "" input: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. `[ id:'sample1', single_end:false ]` - - - raw_file: - type: file - description: File to be compressed - pattern: "*.*" - + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. `[ id:'sample1', single_end:false ]` + - raw_file: + type: file + description: File to be compressed + pattern: "*.*" output: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. `[ id:'sample1', single_end:false ]` - - archive: - type: file - description: The compressed file - pattern: "*.gz" - + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. `[ id:'sample1', single_end:false ]` + - $archive: + type: file + description: The compressed file + pattern: "*.gz" - versions: - type: file - description: File containing software versions - pattern: "versions.yml" - + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@leoisl" maintainers: diff --git a/modules/nf-core/pigz/compress/tests/main.nf.test b/modules/nf-core/pigz/compress/tests/main.nf.test index 248d40fb..b3cb25e3 100644 --- a/modules/nf-core/pigz/compress/tests/main.nf.test +++ b/modules/nf-core/pigz/compress/tests/main.nf.test @@ -14,7 +14,7 @@ nextflow_process { """ input[0] = [ [ id:'test'], // meta map - file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) ] """ } @@ -34,7 +34,7 @@ nextflow_process { """ input[0] = [ [ id:'test'], // meta map - file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) ] """ } @@ -42,7 +42,11 @@ nextflow_process { then { assertAll( { assert process.success }, - { assert snapshot(file(process.out.archive[0][1]).name).match() } + { assert snapshot( + file(process.out.archive[0][1]).name, + process.out.versions + ).match() + } ) } } diff --git a/modules/nf-core/pigz/compress/tests/main.nf.test.snap b/modules/nf-core/pigz/compress/tests/main.nf.test.snap index 6e50456f..4d8df9f1 100644 --- a/modules/nf-core/pigz/compress/tests/main.nf.test.snap +++ b/modules/nf-core/pigz/compress/tests/main.nf.test.snap @@ -26,12 +26,23 @@ ] } ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.3" + }, "timestamp": "2023-12-11T22:39:53.350546" }, "sarscov2 - genome - fasta - stub": { "content": [ - "genome.fasta.gz" + "genome.fasta.gz", + [ + "versions.yml:md5,ca30e9e1ffa1394ba7eefdac8cf3a3ad" + ] ], - "timestamp": "2023-12-11T22:52:24.309192" + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-30T12:18:32.339508" } } \ No newline at end of file diff --git a/modules/nf-core/samtools/flagstat/environment.yml b/modules/nf-core/samtools/flagstat/environment.yml index bd57cb54..62054fc9 100644 --- a/modules/nf-core/samtools/flagstat/environment.yml +++ b/modules/nf-core/samtools/flagstat/environment.yml @@ -1,8 +1,8 @@ -name: samtools_flagstat +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda - - defaults dependencies: - - bioconda::samtools=1.19.2 - - bioconda::htslib=1.19.1 + - bioconda::htslib=1.21 + - bioconda::samtools=1.21 diff --git a/modules/nf-core/samtools/flagstat/main.nf b/modules/nf-core/samtools/flagstat/main.nf index eb5f5252..4a499727 100644 --- a/modules/nf-core/samtools/flagstat/main.nf +++ b/modules/nf-core/samtools/flagstat/main.nf @@ -4,8 +4,8 @@ process SAMTOOLS_FLAGSTAT { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/samtools:1.19.2--h50ea8bc_0' : - 'biocontainers/samtools:1.19.2--h50ea8bc_0' }" + 'https://depot.galaxyproject.org/singularity/samtools:1.21--h50ea8bc_0' : + 'biocontainers/samtools:1.21--h50ea8bc_0' }" input: tuple val(meta), path(bam), path(bai) diff --git a/modules/nf-core/samtools/flagstat/meta.yml b/modules/nf-core/samtools/flagstat/meta.yml index 97991358..cdc4c254 100644 --- a/modules/nf-core/samtools/flagstat/meta.yml +++ b/modules/nf-core/samtools/flagstat/meta.yml @@ -1,5 +1,6 @@ name: samtools_flagstat -description: Counts the number of alignments in a BAM/CRAM/SAM file for each FLAG type +description: Counts the number of alignments in a BAM/CRAM/SAM file for each FLAG + type keywords: - stats - mapping @@ -17,34 +18,37 @@ tools: documentation: http://www.htslib.org/doc/samtools.html doi: 10.1093/bioinformatics/btp352 licence: ["MIT"] + identifier: biotools:samtools input: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - bam: - type: file - description: BAM/CRAM/SAM file - pattern: "*.{bam,cram,sam}" - - bai: - type: file - description: Index for BAM/CRAM/SAM file - pattern: "*.{bai,crai,sai}" + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - bam: + type: file + description: BAM/CRAM/SAM file + pattern: "*.{bam,cram,sam}" + - bai: + type: file + description: Index for BAM/CRAM/SAM file + pattern: "*.{bai,crai,sai}" output: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - flagstat: - type: file - description: File containing samtools flagstat output - pattern: "*.{flagstat}" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.flagstat": + type: file + description: File containing samtools flagstat output + pattern: "*.{flagstat}" - versions: - type: file - description: File containing software versions - pattern: "versions.yml" + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@drpatelh" maintainers: diff --git a/modules/nf-core/samtools/flagstat/tests/main.nf.test b/modules/nf-core/samtools/flagstat/tests/main.nf.test index 24c3c04b..3b648a37 100644 --- a/modules/nf-core/samtools/flagstat/tests/main.nf.test +++ b/modules/nf-core/samtools/flagstat/tests/main.nf.test @@ -11,9 +11,30 @@ nextflow_process { test("BAM") { when { - params { - outdir = "$outputDir" + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true) + ]) + """ } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("BAM - stub") { + + options "-stub" + + when { process { """ input[0] = Channel.of([ @@ -28,8 +49,7 @@ nextflow_process { then { assertAll ( { assert process.success }, - { assert snapshot(process.out.flagstat).match("flagstat") }, - { assert snapshot(process.out.versions).match("versions") } + { assert snapshot(process.out).match() } ) } } diff --git a/modules/nf-core/samtools/flagstat/tests/main.nf.test.snap b/modules/nf-core/samtools/flagstat/tests/main.nf.test.snap index a76fc27e..04c3852b 100644 --- a/modules/nf-core/samtools/flagstat/tests/main.nf.test.snap +++ b/modules/nf-core/samtools/flagstat/tests/main.nf.test.snap @@ -1,32 +1,72 @@ { - "flagstat": { + "BAM - stub": { "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test.flagstat:md5,4f7ffd1e6a5e85524d443209ac97d783" + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,108a155f2d4a99f50bf3176904208d27" + ], + "flagstat": [ + [ + { + "id": "test", + "single_end": false + }, + "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,108a155f2d4a99f50bf3176904208d27" ] - ] + } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.04.3" + "nf-test": "0.9.0", + "nextflow": "24.04.4" }, - "timestamp": "2024-02-12T18:31:37.783927" + "timestamp": "2024-09-16T08:02:58.866491759" }, - "versions": { + "BAM": { "content": [ - [ - "versions.yml:md5,fd0030ce49ab3a92091ad80260226452" - ] + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.flagstat:md5,4f7ffd1e6a5e85524d443209ac97d783" + ] + ], + "1": [ + "versions.yml:md5,108a155f2d4a99f50bf3176904208d27" + ], + "flagstat": [ + [ + { + "id": "test", + "single_end": false + }, + "test.flagstat:md5,4f7ffd1e6a5e85524d443209ac97d783" + ] + ], + "versions": [ + "versions.yml:md5,108a155f2d4a99f50bf3176904208d27" + ] + } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" + "nf-test": "0.9.0", + "nextflow": "24.04.4" }, - "timestamp": "2024-02-13T16:11:44.299617452" + "timestamp": "2024-09-16T08:02:47.383332837" } } \ No newline at end of file diff --git a/modules/nf-core/samtools/index/environment.yml b/modules/nf-core/samtools/index/environment.yml index a5e50649..62054fc9 100644 --- a/modules/nf-core/samtools/index/environment.yml +++ b/modules/nf-core/samtools/index/environment.yml @@ -1,8 +1,8 @@ -name: samtools_index +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda - - defaults dependencies: - - bioconda::samtools=1.19.2 - - bioconda::htslib=1.19.1 + - bioconda::htslib=1.21 + - bioconda::samtools=1.21 diff --git a/modules/nf-core/samtools/index/main.nf b/modules/nf-core/samtools/index/main.nf index dc14f98d..31175610 100644 --- a/modules/nf-core/samtools/index/main.nf +++ b/modules/nf-core/samtools/index/main.nf @@ -4,8 +4,8 @@ process SAMTOOLS_INDEX { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/samtools:1.19.2--h50ea8bc_0' : - 'biocontainers/samtools:1.19.2--h50ea8bc_0' }" + 'https://depot.galaxyproject.org/singularity/samtools:1.21--h50ea8bc_0' : + 'biocontainers/samtools:1.21--h50ea8bc_0' }" input: tuple val(meta), path(input) @@ -35,10 +35,11 @@ process SAMTOOLS_INDEX { """ stub: + def args = task.ext.args ?: '' + def extension = file(input).getExtension() == 'cram' ? + "crai" : args.contains("-c") ? "csi" : "bai" """ - touch ${input}.bai - touch ${input}.crai - touch ${input}.csi + touch ${input}.${extension} cat <<-END_VERSIONS > versions.yml "${task.process}": diff --git a/modules/nf-core/samtools/index/meta.yml b/modules/nf-core/samtools/index/meta.yml index 01a4ee03..db8df0d5 100644 --- a/modules/nf-core/samtools/index/meta.yml +++ b/modules/nf-core/samtools/index/meta.yml @@ -15,38 +15,52 @@ tools: documentation: http://www.htslib.org/doc/samtools.html doi: 10.1093/bioinformatics/btp352 licence: ["MIT"] + identifier: biotools:samtools input: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - bam: - type: file - description: BAM/CRAM/SAM file - pattern: "*.{bam,cram,sam}" + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - input: + type: file + description: input file output: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - bai: - type: file - description: BAM/CRAM/SAM index file - pattern: "*.{bai,crai,sai}" - - crai: - type: file - description: BAM/CRAM/SAM index file - pattern: "*.{bai,crai,sai}" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.bai": + type: file + description: BAM/CRAM/SAM index file + pattern: "*.{bai,crai,sai}" - csi: - type: file - description: CSI index file - pattern: "*.{csi}" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.csi": + type: file + description: CSI index file + pattern: "*.{csi}" + - crai: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.crai": + type: file + description: BAM/CRAM/SAM index file + pattern: "*.{bai,crai,sai}" - versions: - type: file - description: File containing software versions - pattern: "versions.yml" + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@drpatelh" - "@ewels" diff --git a/modules/nf-core/samtools/index/tests/main.nf.test b/modules/nf-core/samtools/index/tests/main.nf.test index bb7756d1..ca34fb5c 100644 --- a/modules/nf-core/samtools/index/tests/main.nf.test +++ b/modules/nf-core/samtools/index/tests/main.nf.test @@ -9,11 +9,7 @@ nextflow_process { tag "samtools/index" test("bai") { - when { - params { - outdir = "$outputDir" - } process { """ input[0] = Channel.of([ @@ -27,18 +23,13 @@ nextflow_process { then { assertAll ( { assert process.success }, - { assert snapshot(process.out.bai).match("bai") }, - { assert snapshot(process.out.versions).match("bai_versions") } + { assert snapshot(process.out).match() } ) } } test("crai") { - when { - params { - outdir = "$outputDir" - } process { """ input[0] = Channel.of([ @@ -52,20 +43,83 @@ nextflow_process { then { assertAll ( { assert process.success }, - { assert snapshot(process.out.crai).match("crai") }, - { assert snapshot(process.out.versions).match("crai_versions") } + { assert snapshot(process.out).match() } ) } } test("csi") { - config "./csi.nextflow.config" when { - params { - outdir = "$outputDir" + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.csi[0][1]).name, + process.out.versions + ).match() } + ) + } + } + + test("bai - stub") { + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("crai - stub") { + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.recalibrated.sorted.cram', checkIfExists: true) + ]) + """ } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("csi - stub") { + options "-stub" + config "./csi.nextflow.config" + + when { process { """ input[0] = Channel.of([ @@ -79,8 +133,7 @@ nextflow_process { then { assertAll ( { assert process.success }, - { assert path(process.out.csi.get(0).get(1)).exists() }, - { assert snapshot(process.out.versions).match("csi_versions") } + { assert snapshot(process.out).match() } ) } } diff --git a/modules/nf-core/samtools/index/tests/main.nf.test.snap b/modules/nf-core/samtools/index/tests/main.nf.test.snap index 3dc8e7de..72d65e81 100644 --- a/modules/nf-core/samtools/index/tests/main.nf.test.snap +++ b/modules/nf-core/samtools/index/tests/main.nf.test.snap @@ -1,74 +1,250 @@ { - "crai_versions": { + "csi - stub": { "content": [ - [ - "versions.yml:md5,cc4370091670b64bba7c7206403ffb3e" - ] + { + "0": [ + + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.paired_end.sorted.bam.csi:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + + ], + "3": [ + "versions.yml:md5,5e09a6fdf76de396728f877193d72315" + ], + "bai": [ + + ], + "crai": [ + + ], + "csi": [ + [ + { + "id": "test", + "single_end": false + }, + "test.paired_end.sorted.bam.csi:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,5e09a6fdf76de396728f877193d72315" + ] + } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" + "nf-test": "0.9.0", + "nextflow": "24.04.4" }, - "timestamp": "2024-02-13T16:12:00.324667957" + "timestamp": "2024-09-16T08:21:25.261127166" }, - "csi_versions": { + "crai - stub": { "content": [ - [ - "versions.yml:md5,cc4370091670b64bba7c7206403ffb3e" - ] + { + "0": [ + + ], + "1": [ + + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test.paired_end.recalibrated.sorted.cram.crai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + "versions.yml:md5,5e09a6fdf76de396728f877193d72315" + ], + "bai": [ + + ], + "crai": [ + [ + { + "id": "test", + "single_end": false + }, + "test.paired_end.recalibrated.sorted.cram.crai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "csi": [ + + ], + "versions": [ + "versions.yml:md5,5e09a6fdf76de396728f877193d72315" + ] + } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" + "nf-test": "0.9.0", + "nextflow": "24.04.4" }, - "timestamp": "2024-02-13T16:12:07.885103162" + "timestamp": "2024-09-16T08:21:12.653194876" }, - "crai": { + "bai - stub": { "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test.paired_end.recalibrated.sorted.cram.crai:md5,14bc3bd5c89cacc8f4541f9062429029" + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.paired_end.sorted.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + + ], + "2": [ + + ], + "3": [ + "versions.yml:md5,5e09a6fdf76de396728f877193d72315" + ], + "bai": [ + [ + { + "id": "test", + "single_end": false + }, + "test.paired_end.sorted.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "crai": [ + + ], + "csi": [ + + ], + "versions": [ + "versions.yml:md5,5e09a6fdf76de396728f877193d72315" ] - ] + } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.04.3" + "nf-test": "0.9.0", + "nextflow": "24.04.4" }, - "timestamp": "2024-02-12T18:41:38.446424" + "timestamp": "2024-09-16T08:21:01.854932651" }, - "bai": { + "csi": { "content": [ + "test.paired_end.sorted.bam.csi", [ - [ - { - "id": "test", - "single_end": false - }, - "test.paired_end.sorted.bam.bai:md5,704c10dd1326482448ca3073fdebc2f4" - ] + "versions.yml:md5,5e09a6fdf76de396728f877193d72315" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.04.3" + "nf-test": "0.9.0", + "nextflow": "24.04.4" }, - "timestamp": "2024-02-12T18:40:46.579747" + "timestamp": "2024-09-16T08:20:51.485364222" }, - "bai_versions": { + "crai": { "content": [ - [ - "versions.yml:md5,cc4370091670b64bba7c7206403ffb3e" - ] + { + "0": [ + + ], + "1": [ + + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test.paired_end.recalibrated.sorted.cram.crai:md5,14bc3bd5c89cacc8f4541f9062429029" + ] + ], + "3": [ + "versions.yml:md5,5e09a6fdf76de396728f877193d72315" + ], + "bai": [ + + ], + "crai": [ + [ + { + "id": "test", + "single_end": false + }, + "test.paired_end.recalibrated.sorted.cram.crai:md5,14bc3bd5c89cacc8f4541f9062429029" + ] + ], + "csi": [ + + ], + "versions": [ + "versions.yml:md5,5e09a6fdf76de396728f877193d72315" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-16T08:20:40.518873972" + }, + "bai": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.paired_end.sorted.bam.bai:md5,704c10dd1326482448ca3073fdebc2f4" + ] + ], + "1": [ + + ], + "2": [ + + ], + "3": [ + "versions.yml:md5,5e09a6fdf76de396728f877193d72315" + ], + "bai": [ + [ + { + "id": "test", + "single_end": false + }, + "test.paired_end.sorted.bam.bai:md5,704c10dd1326482448ca3073fdebc2f4" + ] + ], + "crai": [ + + ], + "csi": [ + + ], + "versions": [ + "versions.yml:md5,5e09a6fdf76de396728f877193d72315" + ] + } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" + "nf-test": "0.9.0", + "nextflow": "24.04.4" }, - "timestamp": "2024-02-13T16:11:51.641425452" + "timestamp": "2024-09-16T08:20:21.184050361" } } \ No newline at end of file diff --git a/modules/nf-core/samtools/view/environment.yml b/modules/nf-core/samtools/view/environment.yml index b0676f33..02cda6e6 100644 --- a/modules/nf-core/samtools/view/environment.yml +++ b/modules/nf-core/samtools/view/environment.yml @@ -1,8 +1,10 @@ -name: samtools_view +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda - - defaults dependencies: - - bioconda::samtools=1.19.2 - - bioconda::htslib=1.19.1 + # renovate: datasource=conda depName=bioconda/htslib + - bioconda::htslib=1.21 + # renovate: datasource=conda depName=bioconda/samtools + - bioconda::samtools=1.21 diff --git a/modules/nf-core/samtools/view/main.nf b/modules/nf-core/samtools/view/main.nf index 5a8989d6..41fa3d6a 100644 --- a/modules/nf-core/samtools/view/main.nf +++ b/modules/nf-core/samtools/view/main.nf @@ -4,8 +4,8 @@ process SAMTOOLS_VIEW { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/samtools:1.19.2--h50ea8bc_0' : - 'biocontainers/samtools:1.19.2--h50ea8bc_0' }" + 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/9e/9edc2564215d5cd137a8b25ca8a311600987186d406b092022444adf3c4447f7/data' : + 'community​.wave​.seqera​.io/library/htslib_samtools:1​.21--6cb89bfd40cbaabf' }" input: tuple val(meta), path(input), path(index) @@ -13,13 +13,15 @@ process SAMTOOLS_VIEW { path qname output: - tuple val(meta), path("*.bam"), emit: bam, optional: true - tuple val(meta), path("*.cram"), emit: cram, optional: true - tuple val(meta), path("*.sam"), emit: sam, optional: true - tuple val(meta), path("*.bai"), emit: bai, optional: true - tuple val(meta), path("*.csi"), emit: csi, optional: true - tuple val(meta), path("*.crai"), emit: crai, optional: true - path "versions.yml", emit: versions + tuple val(meta), path("${prefix}.bam"), emit: bam, optional: true + tuple val(meta), path("${prefix}.cram"), emit: cram, optional: true + tuple val(meta), path("${prefix}.sam"), emit: sam, optional: true + tuple val(meta), path("${prefix}.${file_type}.bai"), emit: bai, optional: true + tuple val(meta), path("${prefix}.${file_type}.csi"), emit: csi, optional: true + tuple val(meta), path("${prefix}.${file_type}.crai"), emit: crai, optional: true + tuple val(meta), path("${prefix}.unselected.${file_type}"), emit: unselected, optional: true + tuple val(meta), path("${prefix}.unselected.${file_type}.{bai,csi,crsi}"), emit: unselected_index, optional: true + path "versions.yml", emit: versions when: task.ext.when == null || task.ext.when @@ -27,13 +29,13 @@ process SAMTOOLS_VIEW { script: def args = task.ext.args ?: '' def args2 = task.ext.args2 ?: '' - def prefix = task.ext.prefix ?: "${meta.id}" + prefix = task.ext.prefix ?: "${meta.id}" def reference = fasta ? "--reference ${fasta}" : "" - def readnames = qname ? "--qname-file ${qname}": "" - def file_type = args.contains("--output-fmt sam") ? "sam" : - args.contains("--output-fmt bam") ? "bam" : - args.contains("--output-fmt cram") ? "cram" : - input.getExtension() + file_type = args.contains("--output-fmt sam") ? "sam" : + args.contains("--output-fmt bam") ? "bam" : + args.contains("--output-fmt cram") ? "cram" : + input.getExtension() + readnames = qname ? "--qname-file ${qname} --output-unselected ${prefix}.unselected.${file_type}": "" if ("$input" == "${prefix}.${file_type}") error "Input and output names are the same, use \"task.ext.prefix\" to disambiguate!" """ samtools \\ @@ -54,14 +56,14 @@ process SAMTOOLS_VIEW { stub: def args = task.ext.args ?: '' - def prefix = task.ext.prefix ?: "${meta.id}" - def file_type = args.contains("--output-fmt sam") ? "sam" : - args.contains("--output-fmt bam") ? "bam" : - args.contains("--output-fmt cram") ? "cram" : - input.getExtension() + prefix = task.ext.prefix ?: "${meta.id}" + file_type = args.contains("--output-fmt sam") ? "sam" : + args.contains("--output-fmt bam") ? "bam" : + args.contains("--output-fmt cram") ? "cram" : + input.getExtension() if ("$input" == "${prefix}.${file_type}") error "Input and output names are the same, use \"task.ext.prefix\" to disambiguate!" - def index = args.contains("--write-index") ? "touch ${prefix}.csi" : "" + def index = args.contains("--write-index") ? "touch ${prefix}.${file_type}.csi" : "" """ touch ${prefix}.${file_type} diff --git a/modules/nf-core/samtools/view/meta.yml b/modules/nf-core/samtools/view/meta.yml index 3dadafae..caa7b015 100644 --- a/modules/nf-core/samtools/view/meta.yml +++ b/modules/nf-core/samtools/view/meta.yml @@ -15,68 +15,120 @@ tools: documentation: http://www.htslib.org/doc/samtools.html doi: 10.1093/bioinformatics/btp352 licence: ["MIT"] + identifier: biotools:samtools input: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - input: - type: file - description: BAM/CRAM/SAM file - pattern: "*.{bam,cram,sam}" - - index: - type: file - description: BAM.BAI/BAM.CSI/CRAM.CRAI file (optional) - pattern: "*.{.bai,.csi,.crai}" - - meta2: - type: map - description: | - Groovy Map containing reference information - e.g. [ id:'test' ] - - fasta: - type: file - description: Reference file the CRAM was created with (optional) - pattern: "*.{fasta,fa}" - - qname: - type: file - description: Optional file with read names to output only select alignments - pattern: "*.{txt,list}" + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - input: + type: file + description: BAM/CRAM/SAM file + pattern: "*.{bam,cram,sam}" + - index: + type: file + description: BAM.BAI/BAM.CSI/CRAM.CRAI file (optional) + pattern: "*.{.bai,.csi,.crai}" + - - meta2: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'test' ] + - fasta: + type: file + description: Reference file the CRAM was created with (optional) + pattern: "*.{fasta,fa}" + - - qname: + type: file + description: Optional file with read names to output only select alignments + pattern: "*.{txt,list}" output: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - bam: - type: file - description: optional filtered/converted BAM file - pattern: "*.{bam}" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - ${prefix}.bam: + type: file + description: optional filtered/converted BAM file + pattern: "*.{bam}" - cram: - type: file - description: optional filtered/converted CRAM file - pattern: "*.{cram}" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - ${prefix}.cram: + type: file + description: optional filtered/converted CRAM file + pattern: "*.{cram}" - sam: - type: file - description: optional filtered/converted SAM file - pattern: "*.{sam}" - # bai, csi, and crai are created with `--write-index` + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - ${prefix}.sam: + type: file + description: optional filtered/converted SAM file + pattern: "*.{sam}" - bai: - type: file - description: optional BAM file index - pattern: "*.{bai}" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - ${prefix}.${file_type}.bai: + type: file + description: optional BAM file index + pattern: "*.{bai}" - csi: - type: file - description: optional tabix BAM file index - pattern: "*.{csi}" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - ${prefix}.${file_type}.csi: + type: file + description: optional tabix BAM file index + pattern: "*.{csi}" - crai: - type: file - description: optional CRAM file index - pattern: "*.{crai}" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - ${prefix}.${file_type}.crai: + type: file + description: optional CRAM file index + pattern: "*.{crai}" + - unselected: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - ${prefix}.unselected.${file_type}: + type: file + description: optional file with unselected alignments + pattern: "*.unselected.{bam,cram,sam}" + - unselected_index: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - ${prefix}.unselected.${file_type}.{bai,csi,crsi}: + type: file + description: index for the "unselected" file + pattern: "*.unselected.{bai,csi,crai}" - versions: - type: file - description: File containing software versions - pattern: "versions.yml" + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@drpatelh" - "@joseespinosa" diff --git a/modules/nf-core/samtools/view/tests/main.nf.test b/modules/nf-core/samtools/view/tests/main.nf.test index 45a0defb..37b81a91 100644 --- a/modules/nf-core/samtools/view/tests/main.nf.test +++ b/modules/nf-core/samtools/view/tests/main.nf.test @@ -172,6 +172,8 @@ nextflow_process { { assert snapshot(process.out.crai).match("cram_to_bam_index_qname_crai") }, { assert snapshot(process.out.cram).match("cram_to_bam_index_qname_cram") }, { assert snapshot(process.out.sam).match("cram_to_bam_index_qname_sam") }, + { assert snapshot(file(process.out.unselected[0][1]).name).match("cram_to_bam_index_qname_unselected") }, + { assert snapshot(file(process.out.unselected_index[0][1]).name).match("cram_to_bam_index_qname_unselected_csi") }, { assert snapshot(process.out.versions).match("cram_to_bam_index_qname_versions") } ) } diff --git a/modules/nf-core/samtools/view/tests/main.nf.test.snap b/modules/nf-core/samtools/view/tests/main.nf.test.snap index f55943a7..63849b03 100644 --- a/modules/nf-core/samtools/view/tests/main.nf.test.snap +++ b/modules/nf-core/samtools/view/tests/main.nf.test.snap @@ -56,14 +56,14 @@ "bam_stub_versions": { "content": [ [ - "versions.yml:md5,4ea32c57d546102a1b32d9693ada7cf1" + "versions.yml:md5,176db5ec46b965219604bcdbb3ef9e07" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" + "nf-test": "0.9.0", + "nextflow": "24.04.4" }, - "timestamp": "2024-02-13T16:13:09.713353823" + "timestamp": "2024-09-16T09:26:24.461775464" }, "cram_to_bam_index_cram": { "content": [ @@ -169,6 +169,16 @@ }, "timestamp": "2024-02-12T19:37:56.490286" }, + "cram_to_bam_index_qname_unselected_csi": { + "content": [ + "test.unselected.bam.csi" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.04.3" + }, + "timestamp": "2024-02-12T19:38:23.328458" + }, "bam_csi": { "content": [ [ @@ -208,14 +218,14 @@ "cram_to_bam_index_qname_versions": { "content": [ [ - "versions.yml:md5,4ea32c57d546102a1b32d9693ada7cf1" + "versions.yml:md5,176db5ec46b965219604bcdbb3ef9e07" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" + "nf-test": "0.9.0", + "nextflow": "24.04.4" }, - "timestamp": "2024-02-13T16:13:03.935041046" + "timestamp": "2024-09-16T09:25:51.953436682" }, "cram_to_bam_bam": { "content": [ @@ -240,14 +250,14 @@ "cram_to_bam_index_versions": { "content": [ [ - "versions.yml:md5,4ea32c57d546102a1b32d9693ada7cf1" + "versions.yml:md5,176db5ec46b965219604bcdbb3ef9e07" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" + "nf-test": "0.9.0", + "nextflow": "24.04.4" }, - "timestamp": "2024-02-13T16:12:55.910685496" + "timestamp": "2024-09-16T09:25:14.475388399" }, "cram_to_bam_bai": { "content": [ @@ -264,14 +274,14 @@ "cram_to_bam_versions": { "content": [ [ - "versions.yml:md5,4ea32c57d546102a1b32d9693ada7cf1" + "versions.yml:md5,176db5ec46b965219604bcdbb3ef9e07" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" + "nf-test": "0.9.0", + "nextflow": "24.04.4" }, - "timestamp": "2024-02-13T16:12:47.715221169" + "timestamp": "2024-09-16T09:24:49.673441798" }, "cram_bam": { "content": [ @@ -355,17 +365,37 @@ }, "timestamp": "2024-02-12T19:38:23.322874" }, + "cram_to_bam_index_qname_unselected": { + "content": [ + "test.unselected.bam" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.04.3" + }, + "timestamp": "2024-02-12T19:38:23.322874" + }, + "cram_to_bam_index_qname_unselected_csi": { + "content": [ + "test.unselected.bam.csi" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.04.3" + }, + "timestamp": "2024-02-12T19:38:23.328458" + }, "bam_versions": { "content": [ [ - "versions.yml:md5,4ea32c57d546102a1b32d9693ada7cf1" + "versions.yml:md5,176db5ec46b965219604bcdbb3ef9e07" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" + "nf-test": "0.9.0", + "nextflow": "24.04.4" }, - "timestamp": "2024-02-13T16:12:31.692607421" + "timestamp": "2024-09-16T09:23:27.151650338" }, "cram_to_bam_index_qname_cram": { "content": [ @@ -430,14 +460,24 @@ "cram_versions": { "content": [ [ - "versions.yml:md5,4ea32c57d546102a1b32d9693ada7cf1" + "versions.yml:md5,176db5ec46b965219604bcdbb3ef9e07" ] ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-16T09:24:12.95416913" + }, + "cram_to_bam_index_qname_unselected": { + "content": [ + "test.unselected.bam" + ], "meta": { "nf-test": "0.8.4", - "nextflow": "24.01.0" + "nextflow": "23.04.3" }, - "timestamp": "2024-02-13T16:12:39.913411036" + "timestamp": "2024-02-12T19:38:23.322874" }, "bam_sam": { "content": [ @@ -477,7 +517,7 @@ }, "bam_stub_csi": { "content": [ - "test.csi" + "test.bam.csi" ], "meta": { "nf-test": "0.8.4", diff --git a/modules/nf-core/seqtk/subseq/environment.yml b/modules/nf-core/seqtk/subseq/environment.yml index 7abe3644..693aa5c1 100644 --- a/modules/nf-core/seqtk/subseq/environment.yml +++ b/modules/nf-core/seqtk/subseq/environment.yml @@ -1,7 +1,5 @@ -name: seqtk_subseq channels: - conda-forge - bioconda - - defaults dependencies: - bioconda::seqtk=1.4 diff --git a/modules/nf-core/seqtk/subseq/meta.yml b/modules/nf-core/seqtk/subseq/meta.yml index 4e8ee19f..2667f40d 100644 --- a/modules/nf-core/seqtk/subseq/meta.yml +++ b/modules/nf-core/seqtk/subseq/meta.yml @@ -6,29 +6,42 @@ keywords: - fastx tools: - seqtk: - description: Seqtk is a fast and lightweight tool for processing sequences in the FASTA or FASTQ format + description: Seqtk is a fast and lightweight tool for processing sequences in + the FASTA or FASTQ format homepage: https://github.com/lh3/seqtk documentation: https://docs.csc.fi/apps/seqtk/ tool_dev_url: https://github.com/lh3/seqtk licence: ["MIT"] + identifier: biotools:seqtk input: - - sequences: - type: file - description: FASTQ/FASTA file - pattern: "*.{fq,fq.gz,fa,fa.gz}" - - filter_list: - type: file - description: BED file or a text file with a list of sequence names - pattern: "*.{bed,lst}" + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test' ] + - sequences: + type: file + description: FASTQ/FASTA file + pattern: "*.{fq,fq.gz,fa,fa.gz}" + - - filter_list: + type: file + description: BED file or a text file with a list of sequence names + pattern: "*.{bed,lst}" output: - - versions: - type: file - description: File containing software versions - pattern: "versions.yml" - sequences: - type: file - description: FASTQ/FASTA file - pattern: "*.{fq.gz,fa.gz}" + - meta: + type: file + description: FASTQ/FASTA file + pattern: "*.{fq.gz,fa.gz}" + - "*.gz": + type: file + description: FASTQ/FASTA file + pattern: "*.{fq.gz,fa.gz}" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@sidorov-si" maintainers: diff --git a/modules/nf-core/seqtk/subseq/tests/main.nf.test b/modules/nf-core/seqtk/subseq/tests/main.nf.test index be5602e3..fa8fad69 100644 --- a/modules/nf-core/seqtk/subseq/tests/main.nf.test +++ b/modules/nf-core/seqtk/subseq/tests/main.nf.test @@ -17,9 +17,9 @@ nextflow_process { """ input[0] = [ [ id:'test' ], - file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) ] - input[1] = file(params.test_data['sarscov2']['genome']['test_bed_gz'], checkIfExists: true) + input[1] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test.bed.gz', checkIfExists: true) """ } } @@ -40,9 +40,9 @@ nextflow_process { """ input[0] = [ [ id:'test' ], - file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) ] - input[1] = file(params.test_data['sarscov2']['genome']['test_bed_gz'], checkIfExists: true) + input[1] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test.bed.gz', checkIfExists: true) """ } } diff --git a/modules/nf-core/windowmasker/mkcounts/environment.yml b/modules/nf-core/windowmasker/mkcounts/environment.yml index e4d72108..777e097e 100644 --- a/modules/nf-core/windowmasker/mkcounts/environment.yml +++ b/modules/nf-core/windowmasker/mkcounts/environment.yml @@ -1,7 +1,5 @@ -name: windowmasker_mkcounts channels: - conda-forge - bioconda - - defaults dependencies: - bioconda::blast=2.15.0 diff --git a/modules/nf-core/windowmasker/mkcounts/meta.yml b/modules/nf-core/windowmasker/mkcounts/meta.yml index 436ed7a5..825a0674 100644 --- a/modules/nf-core/windowmasker/mkcounts/meta.yml +++ b/modules/nf-core/windowmasker/mkcounts/meta.yml @@ -11,31 +11,32 @@ tools: homepage: https://github.com/ncbi/ncbi-cxx-toolkit-public documentation: https://ncbi.github.io/cxx-toolkit/ licence: ["MIT"] + identifier: biotools:windowmasker input: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - ref: - type: file - description: An input nucleotide fasta file. + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - ref: + type: file + description: An input nucleotide fasta file. output: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - intervals: - type: file - description: | - An output file containing genomic locations of low - complexity and highly repetitive regions - pattern: "${prefix}.txt" + - counts: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.txt": + type: file + description: A file containing frequency counts of repetitive units. + pattern: "*.txt" - versions: - type: file - description: File containing software versions - pattern: "versions.yml" + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@DLBPointon" maintainers: diff --git a/modules/nf-core/windowmasker/mkcounts/tests/main.nf.test b/modules/nf-core/windowmasker/mkcounts/tests/main.nf.test index 18c4977c..bf53d7fa 100644 --- a/modules/nf-core/windowmasker/mkcounts/tests/main.nf.test +++ b/modules/nf-core/windowmasker/mkcounts/tests/main.nf.test @@ -20,7 +20,7 @@ nextflow_process { """ input[0] = [ [id: "test" ], - [ file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)] + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] ] """ } @@ -43,7 +43,7 @@ nextflow_process { """ input[0] = [ [id: "test" ], - [ file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)] + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] ] """ } diff --git a/modules/nf-core/windowmasker/ustat/environment.yml b/modules/nf-core/windowmasker/ustat/environment.yml index b83d82e5..777e097e 100644 --- a/modules/nf-core/windowmasker/ustat/environment.yml +++ b/modules/nf-core/windowmasker/ustat/environment.yml @@ -1,7 +1,5 @@ -name: windowmasker_ustat channels: - conda-forge - bioconda - - defaults dependencies: - bioconda::blast=2.15.0 diff --git a/modules/nf-core/windowmasker/ustat/meta.yml b/modules/nf-core/windowmasker/ustat/meta.yml index 6a07c935..bc51a934 100644 --- a/modules/nf-core/windowmasker/ustat/meta.yml +++ b/modules/nf-core/windowmasker/ustat/meta.yml @@ -1,5 +1,6 @@ name: windowmasker_ustat -description: A program to take a counts file and creates a file of genomic co-ordinates to be masked. +description: A program to take a counts file and creates a file of genomic co-ordinates + to be masked. keywords: - fasta - interval @@ -11,39 +12,39 @@ tools: homepage: https://github.com/ncbi/ncbi-cxx-toolkit-public documentation: https://ncbi.github.io/cxx-toolkit/ licence: ["MIT"] + identifier: biotools:windowmasker input: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test' ] - - counts: - type: file - description: Contains count data of repetitive regions. - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - ref: - type: file - description: An input nucleotide fasta file. + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test' ] + - counts: + type: file + description: Contains count data of repetitive regions. + - - meta2: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - ref: + type: file + description: An input nucleotide fasta file. output: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - wm_intervals: - type: file - description: | - An output file containing genomic locations of low - complexity and highly repetitive regions - pattern: "${output}" + - intervals: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - ${output}: + type: file + description: intervals - versions: - type: file - description: File containing software versions - pattern: "versions.yml" + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@DLBPointon" maintainers: diff --git a/modules/nf-core/windowmasker/ustat/tests/main.nf.test b/modules/nf-core/windowmasker/ustat/tests/main.nf.test index 58d91b13..6e02c9c1 100644 --- a/modules/nf-core/windowmasker/ustat/tests/main.nf.test +++ b/modules/nf-core/windowmasker/ustat/tests/main.nf.test @@ -19,7 +19,7 @@ nextflow_process { """ input[0] = [ [id: "test" ], - [ file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)] + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] ] """ } @@ -33,7 +33,7 @@ nextflow_process { input[0] = WINDOWMASKER_MKCOUNTS.out.counts input[1] = [ [id: "test" ], - [ file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)] + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] ] """ } @@ -51,7 +51,7 @@ nextflow_process { input[0] = WINDOWMASKER_MKCOUNTS.out.counts input[1] = [ [id: "test" ], - [ file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)] + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] ] """ } diff --git a/nextflow.config b/nextflow.config index caac9e54..5255f4fe 100644 --- a/nextflow.config +++ b/nextflow.config @@ -182,6 +182,13 @@ profiles { shifter.enabled = false charliecloud.enabled = false } + wave { + apptainer.ociAutoPull = true + singularity.ociAutoPull = true + wave.enabled = true + wave.freeze = true + wave.strategy = 'conda,container' + } gitpod { executor.name = 'local' executor.cpus = 4 diff --git a/workflows/blobtoolkit.nf b/workflows/blobtoolkit.nf index d9effaa4..56690ef9 100644 --- a/workflows/blobtoolkit.nf +++ b/workflows/blobtoolkit.nf @@ -242,7 +242,9 @@ workflow BLOBTOOLKIT { ch_multiqc_files.collect(), ch_multiqc_config.toList(), ch_multiqc_custom_config.toList(), - ch_multiqc_logo.toList() + ch_multiqc_logo.toList(), + [], + [] ) multiqc_report = MULTIQC.out.report.toList() } From 2793130cb7caf6de923a561e3333e986185fdb53 Mon Sep 17 00:00:00 2001 From: Tyler Chafin Date: Thu, 21 Nov 2024 16:46:31 +0000 Subject: [PATCH 02/10] all modules updated exc. BUSCO --- modules.json | 83 ++++++-- .../nf-core/blast/blastn/blast-blastn.diff | 17 +- modules/nf-core/blast/blastn/environment.yml | 4 +- modules/nf-core/blast/blastn/main.nf | 15 +- modules/nf-core/blast/blastn/meta.yml | 61 +++--- .../nf-core/blast/blastn/tests/main.nf.test | 6 +- .../blast/blastn/tests/main.nf.test.snap | 4 +- .../nf-core/diamond/blastp/environment.yml | 2 - modules/nf-core/diamond/blastp/meta.yml | 161 ++++++++------ .../nf-core/diamond/blastp/tests/main.nf.test | 25 ++- .../diamond/blastp/tests/main.nf.test.snap | 32 ++- .../nf-core/diamond/blastx/environment.yml | 2 - modules/nf-core/diamond/blastx/meta.yml | 173 ++++++++++------ .../nf-core/diamond/blastx/tests/main.nf.test | 16 +- .../diamond/blastx/tests/main.nf.test.snap | 23 +- modules/nf-core/fastawindows/environment.yml | 2 - modules/nf-core/fastawindows/main.nf | 19 ++ modules/nf-core/fastawindows/meta.yml | 99 +++++---- .../nf-core/fastawindows/tests/main.nf.test | 57 +++++ .../fastawindows/tests/main.nf.test.snap | 196 ++++++++++++++++++ modules/nf-core/samtools/view/main.nf | 4 +- .../nf-core/samtools/view/samtools-view.diff | 16 ++ 22 files changed, 766 insertions(+), 251 deletions(-) create mode 100644 modules/nf-core/fastawindows/tests/main.nf.test create mode 100644 modules/nf-core/fastawindows/tests/main.nf.test.snap create mode 100644 modules/nf-core/samtools/view/samtools-view.diff diff --git a/modules.json b/modules.json index c87edcd2..88bdef75 100644 --- a/modules.json +++ b/modules.json @@ -7,100 +7,137 @@ "nf-core": { "blast/blastn": { "branch": "master", - "git_sha": "209e5a3e2753c5e628736a662c877c20f341ee15", - "installed_by": ["modules"], + "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "installed_by": [ + "modules" + ], "patch": "modules/nf-core/blast/blastn/blast-blastn.diff" }, "busco": { "branch": "master", "git_sha": "e3126f437c336c826f242842fe51769cfce0ec2d", - "installed_by": ["modules"], + "installed_by": [ + "modules" + ], "patch": "modules/nf-core/busco/busco.diff" }, "cat/cat": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "custom/dumpsoftwareversions": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "diamond/blastp": { "branch": "master", - "git_sha": "b29f6beb86d1d24d680277fb1a3f4de7b8b8a92c", - "installed_by": ["modules"], + "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "installed_by": [ + "modules" + ], "patch": "modules/nf-core/diamond/blastp/diamond-blastp.diff" }, "diamond/blastx": { "branch": "master", - "git_sha": "b29f6beb86d1d24d680277fb1a3f4de7b8b8a92c", - "installed_by": ["modules"], + "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "installed_by": [ + "modules" + ], "patch": "modules/nf-core/diamond/blastx/diamond-blastx.diff" }, "fastawindows": { "branch": "master", - "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"], + "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "installed_by": [ + "modules" + ], "patch": "modules/nf-core/fastawindows/fastawindows.diff" }, "gunzip": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "minimap2/align": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": ["modules"], + "installed_by": [ + "modules" + ], "patch": "modules/nf-core/minimap2/align/minimap2-align.diff" }, "multiqc": { "branch": "master", "git_sha": "cf17ca47590cc578dfb47db1c2a44ef86f89976d", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "pigz/compress": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "samtools/flagstat": { "branch": "master", "git_sha": "b13f07be4c508d6ff6312d354d09f2493243e208", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "samtools/index": { "branch": "master", "git_sha": "b13f07be4c508d6ff6312d354d09f2493243e208", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "samtools/view": { "branch": "master", "git_sha": "669eb24fd82a9d3cb18ad0e73673ecb26827f683", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ], + "patch": "modules/nf-core/samtools/view/samtools-view.diff" }, "seqtk/subseq": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": ["modules"], + "installed_by": [ + "modules" + ], "patch": "modules/nf-core/seqtk/subseq/seqtk-subseq.diff" }, "untar": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "windowmasker/mkcounts": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "windowmasker/ustat": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] } } }, @@ -109,4 +146,4 @@ } } } -} +} \ No newline at end of file diff --git a/modules/nf-core/blast/blastn/blast-blastn.diff b/modules/nf-core/blast/blastn/blast-blastn.diff index e01e07cb..d4a5a366 100644 --- a/modules/nf-core/blast/blastn/blast-blastn.diff +++ b/modules/nf-core/blast/blastn/blast-blastn.diff @@ -25,7 +25,22 @@ Changes in module 'nf-core/blast/blastn' """ if [ "${is_compressed}" == "true" ]; then -@@ -39,8 +41,15 @@ +@@ -35,12 +37,30 @@ + fi + echo Using \$DB + ++ if [ -n "${taxid}" ]; then ++ # Symlink the tax* files (needed for -taxid options to work) ++ for file in taxdb.btd taxdb.bti taxonomy4blast.sqlite3; do ++ if [ ! -f ${db}/\$file ]; then ++ echo "Error: \$file not found in ${db}" ++ exit 1 ++ fi ++ ln -s ${db}/\$file . ++ done ++ fi ++ + blastn \\ -num_threads ${task.cpus} \\ -db \$DB \\ -query ${fasta_name} \\ diff --git a/modules/nf-core/blast/blastn/environment.yml b/modules/nf-core/blast/blastn/environment.yml index cb9b15dd..777e097e 100644 --- a/modules/nf-core/blast/blastn/environment.yml +++ b/modules/nf-core/blast/blastn/environment.yml @@ -1,7 +1,5 @@ -name: blast_blastn channels: - conda-forge - bioconda - - defaults dependencies: - - bioconda::blast=2.14.1 + - bioconda::blast=2.15.0 diff --git a/modules/nf-core/blast/blastn/main.nf b/modules/nf-core/blast/blastn/main.nf index d674989a..84756771 100644 --- a/modules/nf-core/blast/blastn/main.nf +++ b/modules/nf-core/blast/blastn/main.nf @@ -3,8 +3,8 @@ process BLAST_BLASTN { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/blast:2.14.1--pl5321h6f7f691_0': - 'biocontainers/blast:2.14.1--pl5321h6f7f691_0' }" + 'https://depot.galaxyproject.org/singularity/blast:2.15.0--pl5321h6f7f691_1': + 'biocontainers/blast:2.15.0--pl5321h6f7f691_1' }" input: tuple val(meta) , path(fasta) @@ -37,6 +37,17 @@ process BLAST_BLASTN { fi echo Using \$DB + if [ -n "${taxid}" ]; then + # Symlink the tax* files (needed for -taxid options to work) + for file in taxdb.btd taxdb.bti taxonomy4blast.sqlite3; do + if [ ! -f ${db}/\$file ]; then + echo "Error: \$file not found in ${db}" + exit 1 + fi + ln -s ${db}/\$file . + done + fi + blastn \\ -num_threads ${task.cpus} \\ -db \$DB \\ diff --git a/modules/nf-core/blast/blastn/meta.yml b/modules/nf-core/blast/blastn/meta.yml index a0d64dd6..0f5e41bb 100644 --- a/modules/nf-core/blast/blastn/meta.yml +++ b/modules/nf-core/blast/blastn/meta.yml @@ -13,39 +13,42 @@ tools: documentation: https://blast.ncbi.nlm.nih.gov/Blast.cgi?CMD=Web&PAGE_TYPE=Blastdocs doi: 10.1016/S0022-2836(05)80360-2 licence: ["US-Government-Work"] + identifier: "" input: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - fasta: - type: file - description: Input fasta file containing queries sequences - pattern: "*.{fa,fasta,fa.gz,fasta.gz}" - - meta2: - type: map - description: | - Groovy Map containing db information - e.g. [ id:'test2', single_end:false ] - - db: - type: directory - description: Directory containing the blast database - pattern: "*" + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - fasta: + type: file + description: Input fasta file containing queries sequences + pattern: "*.{fa,fasta,fa.gz,fasta.gz}" + - - meta2: + type: map + description: | + Groovy Map containing db information + e.g. [ id:'test2', single_end:false ] + - db: + type: directory + description: Directory containing the blast database + pattern: "*" output: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - txt: - type: file - description: File containing blastn hits - pattern: "*.txt" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.txt": + type: file + description: File containing blastn hits + pattern: "*.txt" - versions: - type: file - description: File containing software versions - pattern: "versions.yml" + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@joseespinosa" - "@drpatelh" diff --git a/modules/nf-core/blast/blastn/tests/main.nf.test b/modules/nf-core/blast/blastn/tests/main.nf.test index 02ecfab5..aacc93c5 100644 --- a/modules/nf-core/blast/blastn/tests/main.nf.test +++ b/modules/nf-core/blast/blastn/tests/main.nf.test @@ -15,7 +15,7 @@ nextflow_process { script "../../makeblastdb/main.nf" process { """ - input[0] = [ [id:'test2'], file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) ] + input[0] = [ [id:'test2'], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) ] """ } } @@ -29,7 +29,7 @@ nextflow_process { } process { """ - input[0] = [ [id:'test'], file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) ] + input[0] = [ [id:'test'], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) ] input[1] = BLAST_MAKEBLASTDB.out.db """ } @@ -53,7 +53,7 @@ nextflow_process { } process { """ - input[0] = [ [id:'test'], file(params.test_data['sarscov2']['genome']['genome_fasta_gz'], checkIfExists: true) ] + input[0] = [ [id:'test'], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.gz', checkIfExists: true) ] input[1] = BLAST_MAKEBLASTDB.out.db """ } diff --git a/modules/nf-core/blast/blastn/tests/main.nf.test.snap b/modules/nf-core/blast/blastn/tests/main.nf.test.snap index d1b5f3f2..dd8b7751 100644 --- a/modules/nf-core/blast/blastn/tests/main.nf.test.snap +++ b/modules/nf-core/blast/blastn/tests/main.nf.test.snap @@ -2,7 +2,7 @@ "versions": { "content": [ [ - "versions.yml:md5,2d5ffadc7035672f6a9e00b01d1751ea" + "versions.yml:md5,faf2471d836ebbf24d96d3e1f8720b17" ] ], "timestamp": "2023-12-11T07:20:03.54997013" @@ -10,7 +10,7 @@ "versions_zipped": { "content": [ [ - "versions.yml:md5,2d5ffadc7035672f6a9e00b01d1751ea" + "versions.yml:md5,faf2471d836ebbf24d96d3e1f8720b17" ] ], "timestamp": "2023-12-11T07:20:12.925782708" diff --git a/modules/nf-core/diamond/blastp/environment.yml b/modules/nf-core/diamond/blastp/environment.yml index 922ea7ed..950c3c5c 100644 --- a/modules/nf-core/diamond/blastp/environment.yml +++ b/modules/nf-core/diamond/blastp/environment.yml @@ -1,7 +1,5 @@ -name: diamond_blastp channels: - conda-forge - bioconda - - defaults dependencies: - bioconda::diamond=2.1.8 diff --git a/modules/nf-core/diamond/blastp/meta.yml b/modules/nf-core/diamond/blastp/meta.yml index bab6801e..fbddfbd0 100644 --- a/modules/nf-core/diamond/blastp/meta.yml +++ b/modules/nf-core/diamond/blastp/meta.yml @@ -13,77 +13,116 @@ tools: tool_dev_url: https://github.com/bbuchfink/diamond doi: "10.1038/s41592-021-01101-x" licence: ["GPL v3.0"] + identifier: biotools:diamond input: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - fasta: - type: file - description: Input fasta file containing query sequences - pattern: "*.{fa,fasta,fa.gz,fasta.gz}" - - meta2: - type: map - description: | - Groovy Map containing db information - e.g. [ id:'test2', single_end:false ] - - db: - type: file - description: File of the indexed DIAMOND database - pattern: "*.dmnd" - - out_ext: - type: string - description: | - Specify the type of output file to be generated. `blast` corresponds to - BLAST pairwise format. `xml` corresponds to BLAST xml format. - `txt` corresponds to to BLAST tabular format. `tsv` corresponds to - taxonomic classification format. - pattern: "blast|xml|txt|daa|sam|tsv|paf" - - blast_columns: - type: string - description: | - Optional space separated list of DIAMOND tabular BLAST output keywords - used for in conjunction with the 'txt' out_ext option (--outfmt 6). Options: - qseqid sseqid pident length mismatch gapopen qstart qend sstart send evalue bitscore + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - fasta: + type: file + description: Input fasta file containing query sequences + pattern: "*.{fa,fasta,fa.gz,fasta.gz}" + - - meta2: + type: map + description: | + Groovy Map containing db information + e.g. [ id:'test2', single_end:false ] + - db: + type: file + description: File of the indexed DIAMOND database + pattern: "*.dmnd" + - - out_ext: + type: string + description: | + Specify the type of output file to be generated. `blast` corresponds to + BLAST pairwise format. `xml` corresponds to BLAST xml format. + `txt` corresponds to to BLAST tabular format. `tsv` corresponds to + taxonomic classification format. + pattern: "blast|xml|txt|daa|sam|tsv|paf" + - - blast_columns: + type: string + description: | + Optional space separated list of DIAMOND tabular BLAST output keywords + used for in conjunction with the 'txt' out_ext option (--outfmt 6). Options: + qseqid sseqid pident length mismatch gapopen qstart qend sstart send evalue bitscore output: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - blast: - type: file - description: File containing blastp hits - pattern: "*.{blast}" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.blast": + type: file + description: File containing blastp hits + pattern: "*.{blast}" - xml: - type: file - description: File containing blastp hits - pattern: "*.{xml}" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.xml": + type: file + description: File containing blastp hits + pattern: "*.{xml}" - txt: - type: file - description: File containing hits in tabular BLAST format. - pattern: "*.{txt}" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.txt": + type: file + description: File containing hits in tabular BLAST format. + pattern: "*.{txt}" - daa: - type: file - description: File containing hits DAA format - pattern: "*.{daa}" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.daa": + type: file + description: File containing hits DAA format + pattern: "*.{daa}" - sam: - type: file - description: File containing aligned reads in SAM format - pattern: "*.{sam}" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.sam": + type: file + description: File containing aligned reads in SAM format + pattern: "*.{sam}" - tsv: - type: file - description: Tab separated file containing taxonomic classification of hits - pattern: "*.{tsv}" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.tsv": + type: file + description: Tab separated file containing taxonomic classification of hits + pattern: "*.{tsv}" - paf: - type: file - description: File containing aligned reads in pairwise mapping format format - pattern: "*.{paf}" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.paf": + type: file + description: File containing aligned reads in pairwise mapping format format + pattern: "*.{paf}" - versions: - type: file - description: File containing software versions - pattern: "versions.yml" + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@spficklin" - "@jfy133" diff --git a/modules/nf-core/diamond/blastp/tests/main.nf.test b/modules/nf-core/diamond/blastp/tests/main.nf.test index 672bf050..f21e926d 100644 --- a/modules/nf-core/diamond/blastp/tests/main.nf.test +++ b/modules/nf-core/diamond/blastp/tests/main.nf.test @@ -6,6 +6,7 @@ nextflow_process { tag "modules" tag "modules_nfcore" tag "diamond" + tag "diamond/makedb" tag "diamond/blastp" setup { @@ -13,7 +14,7 @@ nextflow_process { script "../../makedb/main.nf" process { """ - input[0] = [ [id:'test2'], [ file(params.test_data['sarscov2']['genome']['proteome_fasta'], checkIfExists: true) ] ] + input[0] = [ [id:'test2'], [ file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/proteome.fasta', checkIfExists: true) ] ] input[1] = [] input[2] = [] input[3] = [] @@ -30,7 +31,7 @@ nextflow_process { } process { """ - input[0] = [ [id:'test'], file(params.test_data['sarscov2']['genome']['proteome_fasta'], checkIfExists: true) ] + input[0] = [ [id:'test'], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/proteome.fasta', checkIfExists: true) ] input[1] = DIAMOND_MAKEDB.out.db input[2] = 'txt' input[3] = 'qseqid qlen' @@ -41,8 +42,11 @@ nextflow_process { then { assertAll( { assert process.success }, - { assert snapshot(process.out.txt).match("txt") }, - { assert process.out.versions } + { assert snapshot( + process.out.txt, + process.out.versions + ).match() + } ) } @@ -56,7 +60,7 @@ nextflow_process { } process { """ - input[0] = [ [id:'test'], file(params.test_data['sarscov2']['genome']['proteome_fasta_gz'], checkIfExists: true) ] + input[0] = [ [id:'test'], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/proteome.fasta.gz', checkIfExists: true) ] input[1] = DIAMOND_MAKEDB.out.db input[2] = 'txt' input[3] = 'qseqid qlen' @@ -67,8 +71,11 @@ nextflow_process { then { assertAll( { assert process.success }, - { assert snapshot(process.out.txt).match("gz_txt") }, - { assert process.out.versions } + { assert snapshot( + process.out.txt, + process.out.versions + ).match("gz_txt") + } ) } @@ -82,7 +89,7 @@ nextflow_process { } process { """ - input[0] = [ [id:'test'], file(params.test_data['sarscov2']['genome']['proteome_fasta'], checkIfExists: true) ] + input[0] = [ [id:'test'], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/proteome.fasta', checkIfExists: true) ] input[1] = DIAMOND_MAKEDB.out.db input[2] = 'daa' input[3] = [] @@ -94,7 +101,7 @@ nextflow_process { assertAll( { assert process.success }, { assert process.out.daa }, - { assert process.out.versions } + { assert snapshot(process.out.versions).match() } ) } diff --git a/modules/nf-core/diamond/blastp/tests/main.nf.test.snap b/modules/nf-core/diamond/blastp/tests/main.nf.test.snap index 83575bc1..e323c8b8 100644 --- a/modules/nf-core/diamond/blastp/tests/main.nf.test.snap +++ b/modules/nf-core/diamond/blastp/tests/main.nf.test.snap @@ -1,5 +1,5 @@ { - "txt": { + "Should search for protein hits against a DIAMOND db and return a tab separated output file of hits": { "content": [ [ [ @@ -8,9 +8,16 @@ }, "test.txt:md5,8131b1afd717f3d5f2f2417c5b562e6e" ] + ], + [ + "versions.yml:md5,57a0ebeb0a8a732c941ae0102639a9d0" ] ], - "timestamp": "2023-11-07T10:27:02.453987512" + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-29T14:40:23.906848" }, "gz_txt": { "content": [ @@ -21,8 +28,27 @@ }, "test.txt:md5,8131b1afd717f3d5f2f2417c5b562e6e" ] + ], + [ + "versions.yml:md5,57a0ebeb0a8a732c941ae0102639a9d0" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-29T14:40:29.865487" + }, + "Should search for protein hits against a DIAMOND db and return a daa format file of hits": { + "content": [ + [ + "versions.yml:md5,57a0ebeb0a8a732c941ae0102639a9d0" ] ], - "timestamp": "2023-11-07T09:41:13.934994026" + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-29T14:40:35.362027" } } \ No newline at end of file diff --git a/modules/nf-core/diamond/blastx/environment.yml b/modules/nf-core/diamond/blastx/environment.yml index 70d6857d..950c3c5c 100644 --- a/modules/nf-core/diamond/blastx/environment.yml +++ b/modules/nf-core/diamond/blastx/environment.yml @@ -1,7 +1,5 @@ -name: diamond_blastx channels: - conda-forge - bioconda - - defaults dependencies: - bioconda::diamond=2.1.8 diff --git a/modules/nf-core/diamond/blastx/meta.yml b/modules/nf-core/diamond/blastx/meta.yml index 17106548..a5c05875 100644 --- a/modules/nf-core/diamond/blastx/meta.yml +++ b/modules/nf-core/diamond/blastx/meta.yml @@ -13,81 +13,126 @@ tools: tool_dev_url: https://github.com/bbuchfink/diamond doi: "10.1038/s41592-021-01101-x" licence: ["GPL v3.0"] + identifier: biotools:diamond input: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - fasta: - type: file - description: Input fasta file containing query sequences - pattern: "*.{fa,fasta,fa.gz,fasta.gz}" - - meta2: - type: map - description: | - Groovy Map containing db information - e.g. [ id:'test2', single_end:false ] - - db: - type: file - description: File of the indexed DIAMOND database - pattern: "*.dmnd" - - out_ext: - type: string - description: | - Specify the type of output file to be generated. `blast` corresponds to - BLAST pairwise format. `xml` corresponds to BLAST xml format. - `txt` corresponds to to BLAST tabular format. `tsv` corresponds to - taxonomic classification format. - pattern: "blast|xml|txt|daa|sam|tsv|paf" - - blast_columns: - type: string - description: | - Optional space separated list of DIAMOND tabular BLAST output keywords - used for in conjunction with the 'txt' out_ext option (--outfmt 6). Options: - qseqid sseqid pident length mismatch gapopen qstart qend sstart send evalue bitscore + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - fasta: + type: file + description: Input fasta file containing query sequences + pattern: "*.{fa,fasta,fa.gz,fasta.gz}" + - - meta2: + type: map + description: | + Groovy Map containing db information + e.g. [ id:'test2', single_end:false ] + - db: + type: file + description: File of the indexed DIAMOND database + pattern: "*.dmnd" + - - out_ext: + type: string + description: | + Specify the type of output file to be generated. `blast` corresponds to + BLAST pairwise format. `xml` corresponds to BLAST xml format. + `txt` corresponds to to BLAST tabular format. `tsv` corresponds to + taxonomic classification format. + pattern: "blast|xml|txt|daa|sam|tsv|paf" + - - blast_columns: + type: string + description: | + Optional space separated list of DIAMOND tabular BLAST output keywords + used for in conjunction with the 'txt' out_ext option (--outfmt 6). Options: + qseqid sseqid pident length mismatch gapopen qstart qend sstart send evalue bitscore output: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - blast: - type: file - description: File containing blastp hits - pattern: "*.{blast}" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.blast": + type: file + description: File containing blastp hits + pattern: "*.{blast}" - xml: - type: file - description: File containing blastp hits - pattern: "*.{xml}" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.xml": + type: file + description: File containing blastp hits + pattern: "*.{xml}" - txt: - type: file - description: File containing hits in tabular BLAST format. - pattern: "*.{txt}" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.txt": + type: file + description: File containing hits in tabular BLAST format. + pattern: "*.{txt}" - daa: - type: file - description: File containing hits DAA format - pattern: "*.{daa}" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.daa": + type: file + description: File containing hits DAA format + pattern: "*.{daa}" - sam: - type: file - description: File containing aligned reads in SAM format - pattern: "*.{sam}" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.sam": + type: file + description: File containing aligned reads in SAM format + pattern: "*.{sam}" - tsv: - type: file - description: Tab separated file containing taxonomic classification of hits - pattern: "*.{tsv}" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.tsv": + type: file + description: Tab separated file containing taxonomic classification of hits + pattern: "*.{tsv}" - paf: - type: file - description: File containing aligned reads in pairwise mapping format format - pattern: "*.{paf}" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.paf": + type: file + description: File containing aligned reads in pairwise mapping format format + pattern: "*.{paf}" - log: - type: file - description: Log file containing stdout information - pattern: "*.{log}" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.log": + type: file + description: Log file containing stdout information + pattern: "*.{log}" - versions: - type: file - description: File containing software versions - pattern: "versions.yml" + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@spficklin" - "@jfy133" diff --git a/modules/nf-core/diamond/blastx/tests/main.nf.test b/modules/nf-core/diamond/blastx/tests/main.nf.test index a367f883..b8757403 100644 --- a/modules/nf-core/diamond/blastx/tests/main.nf.test +++ b/modules/nf-core/diamond/blastx/tests/main.nf.test @@ -6,6 +6,7 @@ nextflow_process { tag "modules" tag "modules_nfcore" tag "diamond" + tag "diamond/makedb" tag "diamond/blastx" setup { @@ -13,7 +14,7 @@ nextflow_process { script "../../makedb/main.nf" process { """ - input[0] = [ [id:'test2'], [ file(params.test_data['sarscov2']['genome']['proteome_fasta'], checkIfExists: true) ] ] + input[0] = [ [id:'test2'], [ file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/proteome.fasta', checkIfExists: true) ] ] input[1] = [] input[2] = [] input[3] = [] @@ -30,7 +31,7 @@ nextflow_process { } process { """ - input[0] = [ [id:'test'], file(params.test_data['sarscov2']['genome']['transcriptome_fasta'], checkIfExists: true) ] + input[0] = [ [id:'test'], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/transcriptome.fasta', checkIfExists: true) ] input[1] = DIAMOND_MAKEDB.out.db input[2] = 'tfdfdt' // Nonsense file extension to check default case. input[3] = 'qseqid qlen' @@ -41,9 +42,12 @@ nextflow_process { then { assertAll( { assert process.success }, - { assert snapshot(process.out.txt).match("txt") }, { assert path(process.out.log.get(0).get(1)).readLines().contains("11 queries aligned.") }, - { assert process.out.versions } + { assert snapshot( + process.out.txt, + process.out.versions + ).match() + } ) } @@ -57,7 +61,7 @@ nextflow_process { } process { """ - input[0] = [ [id:'test'], file(params.test_data['sarscov2']['genome']['transcriptome_fasta'], checkIfExists: true) ] + input[0] = [ [id:'test'], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/transcriptome.fasta', checkIfExists: true) ] input[1] = DIAMOND_MAKEDB.out.db input[2] = 'daa' input[3] = [] @@ -70,7 +74,7 @@ nextflow_process { { assert process.success }, { assert process.out.daa }, { assert path(process.out.log.get(0).get(1)).readLines().contains("11 queries aligned.") }, - { assert process.out.versions } + { assert snapshot(process.out.versions).match() } ) } diff --git a/modules/nf-core/diamond/blastx/tests/main.nf.test.snap b/modules/nf-core/diamond/blastx/tests/main.nf.test.snap index 27fb0a31..8a128c99 100644 --- a/modules/nf-core/diamond/blastx/tests/main.nf.test.snap +++ b/modules/nf-core/diamond/blastx/tests/main.nf.test.snap @@ -1,5 +1,17 @@ { - "txt": { + "Should search for transcriptome hits against a DIAMOND db and return the daa format output file of hits": { + "content": [ + [ + "versions.yml:md5,733d944fb173eaf1d1cdf280cd1b3b9c" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-29T14:49:26.843747" + }, + "Should search for transcriptome hits against a DIAMOND db and return the default tab separated output file of hits": { "content": [ [ [ @@ -8,8 +20,15 @@ }, "test.txt:md5,33dc682dabfa44c7089abbc8fe8b84e4" ] + ], + [ + "versions.yml:md5,733d944fb173eaf1d1cdf280cd1b3b9c" ] ], - "timestamp": "2023-11-07T09:42:36.646074348" + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-29T14:49:20.769093" } } \ No newline at end of file diff --git a/modules/nf-core/fastawindows/environment.yml b/modules/nf-core/fastawindows/environment.yml index ce557158..6775fb2e 100644 --- a/modules/nf-core/fastawindows/environment.yml +++ b/modules/nf-core/fastawindows/environment.yml @@ -1,7 +1,5 @@ -name: fastawindows channels: - conda-forge - bioconda - - defaults dependencies: - bioconda::fasta_windows=0.2.4 diff --git a/modules/nf-core/fastawindows/main.nf b/modules/nf-core/fastawindows/main.nf index 40b28436..dcbf696a 100644 --- a/modules/nf-core/fastawindows/main.nf +++ b/modules/nf-core/fastawindows/main.nf @@ -31,6 +31,25 @@ process FASTAWINDOWS { --fasta $fasta \\ --output ${prefix} + cat <<-END_VERSIONS > versions.yml + "${task.process}": + fasta_windows: \$(fasta_windows --version | cut -d' ' -f3) + END_VERSIONS + """ + + stub: + def args = task.ext.args ?: '' + def prefix = task.ext.prefix ?: "${meta.id}" + """ + mkdir -p fw_out + + touch fw_out/${prefix}_freq_windows.tsv + touch fw_out/${prefix}_mononuc_windows.tsv + touch fw_out/${prefix}_dinuc_windows.tsv + touch fw_out/${prefix}_trinuc_windows.tsv + touch fw_out/${prefix}_tetranuc_windows.tsv + + cat <<-END_VERSIONS > versions.yml "${task.process}": fasta_windows: \$(fasta_windows --version | cut -d' ' -f3) diff --git a/modules/nf-core/fastawindows/meta.yml b/modules/nf-core/fastawindows/meta.yml index 494cc1b6..f8ee0043 100644 --- a/modules/nf-core/fastawindows/meta.yml +++ b/modules/nf-core/fastawindows/meta.yml @@ -7,49 +7,78 @@ keywords: - bed tools: - "fastawindows": - description: "fasta_windows is a tool written for Darwin Tree of Life chromosomal level genome assemblies. The executable takes a fasta formatted file and calculates some statistics of interest in windows" + description: "fasta_windows is a tool written for Darwin Tree of Life chromosomal + level genome assemblies. The executable takes a fasta formatted file and calculates + some statistics of interest in windows" homepage: "https://github.com/tolkit/fasta_windows" - licence: "['MIT']" + licence: ["MIT"] + identifier: "" input: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - fasta: - type: file - description: FASTA file - pattern: "*.{fa,fasta,fna}" + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - fasta: + type: file + description: FASTA file + pattern: "*.{fa,fasta,fna}" output: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - versions: - type: file - description: File containing software versions - pattern: "versions.yml" - freq: - type: file - description: TSV file with frequencies and statistics - pattern: "*.{tsv}" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - fw_out/*_freq_windows.tsv: + type: file + description: TSV file with frequencies and statistics + pattern: "*.{tsv}" - mononuc: - type: file - description: TSV file with mononucleotide counts - pattern: "*.{tsv}" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - fw_out/*_mononuc_windows.tsv: + type: file + description: TSV file with mononucleotide counts + pattern: "*.{tsv}" - dinuc: - type: file - description: TSV file with dinucleotide counts - pattern: "*.{tsv}" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - fw_out/*_dinuc_windows.tsv: + type: file + description: TSV file with dinucleotide counts + pattern: "*.{tsv}" - trinuc: - type: file - description: TSV file with trinucleotide counts - pattern: "*.{tsv}" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - fw_out/*_trinuc_windows.tsv: + type: file + description: TSV file with trinucleotide counts + pattern: "*.{tsv}" - tetranuc: - type: file - description: TSV file with tetranucleotide counts - pattern: "*.{tsv}" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - fw_out/*_tetranuc_windows.tsv: + type: file + description: TSV file with tetranucleotide counts + pattern: "*.{tsv}" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@muffato" maintainers: diff --git a/modules/nf-core/fastawindows/tests/main.nf.test b/modules/nf-core/fastawindows/tests/main.nf.test new file mode 100644 index 00000000..f4bea49f --- /dev/null +++ b/modules/nf-core/fastawindows/tests/main.nf.test @@ -0,0 +1,57 @@ + +nextflow_process { + + name "Test Process FASTAWINDOWS" + script "../main.nf" + process "FASTAWINDOWS" + + tag "modules" + tag "modules_nfcore" + tag "fastawindows" + + test("test-fastawindows") { + + when { + process { + """ + input[0] = [ + [ id:'test' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test-fastawindows-stub") { + options '-stub' + + when { + process { + """ + input[0] = [ + [ id:'test' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + +} diff --git a/modules/nf-core/fastawindows/tests/main.nf.test.snap b/modules/nf-core/fastawindows/tests/main.nf.test.snap new file mode 100644 index 00000000..f3474d3e --- /dev/null +++ b/modules/nf-core/fastawindows/tests/main.nf.test.snap @@ -0,0 +1,196 @@ +{ + "test-fastawindows-stub": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test_freq_windows.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test" + }, + "test_mononuc_windows.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test" + }, + "test_dinuc_windows.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + [ + { + "id": "test" + }, + "test_trinuc_windows.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + [ + { + "id": "test" + }, + "test_tetranuc_windows.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "5": [ + "versions.yml:md5,4e46686969aa8883f8092693ebcf7dab" + ], + "dinuc": [ + [ + { + "id": "test" + }, + "test_dinuc_windows.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "freq": [ + [ + { + "id": "test" + }, + "test_freq_windows.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "mononuc": [ + [ + { + "id": "test" + }, + "test_mononuc_windows.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "tetranuc": [ + [ + { + "id": "test" + }, + "test_tetranuc_windows.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "trinuc": [ + [ + { + "id": "test" + }, + "test_trinuc_windows.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,4e46686969aa8883f8092693ebcf7dab" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.4" + }, + "timestamp": "2024-08-30T09:58:57.148076" + }, + "test-fastawindows": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test_freq_windows.tsv:md5,237d50ac5ec2bef3142020d569fa5765" + ] + ], + "1": [ + [ + { + "id": "test" + }, + "test_mononuc_windows.tsv:md5,a1b4437d0c71d9cfd676de6bda2633f0" + ] + ], + "2": [ + [ + { + "id": "test" + }, + "test_dinuc_windows.tsv:md5,696a9f2a4b2114dfbd6b414694f56a11" + ] + ], + "3": [ + [ + { + "id": "test" + }, + "test_trinuc_windows.tsv:md5,dfb05b758f0474e937e2d6ba6fe46dae" + ] + ], + "4": [ + [ + { + "id": "test" + }, + "test_tetranuc_windows.tsv:md5,e621537175ee8019360f8b6e8f4330b7" + ] + ], + "5": [ + "versions.yml:md5,4e46686969aa8883f8092693ebcf7dab" + ], + "dinuc": [ + [ + { + "id": "test" + }, + "test_dinuc_windows.tsv:md5,696a9f2a4b2114dfbd6b414694f56a11" + ] + ], + "freq": [ + [ + { + "id": "test" + }, + "test_freq_windows.tsv:md5,237d50ac5ec2bef3142020d569fa5765" + ] + ], + "mononuc": [ + [ + { + "id": "test" + }, + "test_mononuc_windows.tsv:md5,a1b4437d0c71d9cfd676de6bda2633f0" + ] + ], + "tetranuc": [ + [ + { + "id": "test" + }, + "test_tetranuc_windows.tsv:md5,e621537175ee8019360f8b6e8f4330b7" + ] + ], + "trinuc": [ + [ + { + "id": "test" + }, + "test_trinuc_windows.tsv:md5,dfb05b758f0474e937e2d6ba6fe46dae" + ] + ], + "versions": [ + "versions.yml:md5,4e46686969aa8883f8092693ebcf7dab" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.4" + }, + "timestamp": "2024-08-29T21:22:58.322943" + } +} \ No newline at end of file diff --git a/modules/nf-core/samtools/view/main.nf b/modules/nf-core/samtools/view/main.nf index 41fa3d6a..37e05cec 100644 --- a/modules/nf-core/samtools/view/main.nf +++ b/modules/nf-core/samtools/view/main.nf @@ -4,8 +4,8 @@ process SAMTOOLS_VIEW { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/9e/9edc2564215d5cd137a8b25ca8a311600987186d406b092022444adf3c4447f7/data' : - 'community​.wave​.seqera​.io/library/htslib_samtools:1​.21--6cb89bfd40cbaabf' }" + 'https://depot.galaxyproject.org/singularity/samtools:1.21--h50ea8bc_0' : + 'biocontainers/samtools:1.21--h50ea8bc_0' }" input: tuple val(meta), path(input), path(index) diff --git a/modules/nf-core/samtools/view/samtools-view.diff b/modules/nf-core/samtools/view/samtools-view.diff new file mode 100644 index 00000000..d5c13034 --- /dev/null +++ b/modules/nf-core/samtools/view/samtools-view.diff @@ -0,0 +1,16 @@ +Changes in module 'nf-core/samtools/view' +--- modules/nf-core/samtools/view/main.nf ++++ modules/nf-core/samtools/view/main.nf +@@ -4,8 +4,8 @@ + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? +- 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/9e/9edc2564215d5cd137a8b25ca8a311600987186d406b092022444adf3c4447f7/data' : +- 'community​.wave​.seqera​.io/library/htslib_samtools:1​.21--6cb89bfd40cbaabf' }" ++ 'https://depot.galaxyproject.org/singularity/samtools:1.21--h50ea8bc_0' : ++ 'biocontainers/samtools:1.21--h50ea8bc_0' }" + + input: + tuple val(meta), path(input), path(index) + +************************************************************ From a87c43f333d58f7bb1c70631b5d7d5191699511a Mon Sep 17 00:00:00 2001 From: Tyler Chafin Date: Thu, 21 Nov 2024 17:36:16 +0000 Subject: [PATCH 03/10] busco updated and patched --- conf/modules.config | 4 +- modules.json | 6 +- .../{busco.diff => busco/busco-busco.diff} | 8 +- .../nf-core/busco/{ => busco}/environment.yml | 4 +- modules/nf-core/busco/{ => busco}/main.nf | 33 +- modules/nf-core/busco/busco/meta.yml | 152 +++++ .../nf-core/busco/busco/tests/main.nf.test | 415 ++++++++++++ .../busco/busco/tests/main.nf.test.snap | 230 +++++++ .../busco/tests/nextflow.augustus.config | 5 + .../nf-core/busco/busco/tests/nextflow.config | 5 + .../busco/busco/tests/nextflow.metaeuk.config | 5 + .../nf-core/busco/busco/tests/old_test.yml | 624 ++++++++++++++++++ modules/nf-core/busco/busco/tests/tags.yml | 2 + modules/nf-core/busco/meta.yml | 96 --- subworkflows/local/busco_diamond_blastp.nf | 2 +- 15 files changed, 1472 insertions(+), 119 deletions(-) rename modules/nf-core/busco/{busco.diff => busco/busco-busco.diff} (87%) rename modules/nf-core/busco/{ => busco}/environment.yml (50%) rename modules/nf-core/busco/{ => busco}/main.nf (80%) create mode 100644 modules/nf-core/busco/busco/meta.yml create mode 100644 modules/nf-core/busco/busco/tests/main.nf.test create mode 100644 modules/nf-core/busco/busco/tests/main.nf.test.snap create mode 100644 modules/nf-core/busco/busco/tests/nextflow.augustus.config create mode 100644 modules/nf-core/busco/busco/tests/nextflow.config create mode 100644 modules/nf-core/busco/busco/tests/nextflow.metaeuk.config create mode 100644 modules/nf-core/busco/busco/tests/old_test.yml create mode 100644 modules/nf-core/busco/busco/tests/tags.yml delete mode 100644 modules/nf-core/busco/meta.yml diff --git a/conf/modules.config b/conf/modules.config index ceeb9c67..9f8b7aec 100644 --- a/conf/modules.config +++ b/conf/modules.config @@ -96,8 +96,8 @@ process { ext.args = { 'test' in workflow.profile.tokenize(',') ? // Additional configuration to speed processes up during testing. // Note: BUSCO *must* see the double-quotes around the parameters - '--force --metaeuk_parameters \'"-s=2"\' --metaeuk_rerun_parameters \'"-s=2"\'' - : '--force' } + '--force --metaeuk --metaeuk_parameters \'"-s=2"\' --metaeuk_rerun_parameters \'"-s=2"\'' + : '--force --metaeuk' } } withName: "RESTRUCTUREBUSCODIR" { diff --git a/modules.json b/modules.json index 88bdef75..ed215220 100644 --- a/modules.json +++ b/modules.json @@ -13,13 +13,13 @@ ], "patch": "modules/nf-core/blast/blastn/blast-blastn.diff" }, - "busco": { + "busco/busco": { "branch": "master", - "git_sha": "e3126f437c336c826f242842fe51769cfce0ec2d", + "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", "installed_by": [ "modules" ], - "patch": "modules/nf-core/busco/busco.diff" + "patch": "modules/nf-core/busco/busco/busco-busco.diff" }, "cat/cat": { "branch": "master", diff --git a/modules/nf-core/busco/busco.diff b/modules/nf-core/busco/busco/busco-busco.diff similarity index 87% rename from modules/nf-core/busco/busco.diff rename to modules/nf-core/busco/busco/busco-busco.diff index 775788fb..1317574a 100644 --- a/modules/nf-core/busco/busco.diff +++ b/modules/nf-core/busco/busco/busco-busco.diff @@ -1,8 +1,8 @@ -Changes in module 'nf-core/busco' ---- modules/nf-core/busco/main.nf -+++ modules/nf-core/busco/main.nf +Changes in module 'nf-core/busco/busco' +--- modules/nf-core/busco/busco/main.nf ++++ modules/nf-core/busco/busco/main.nf @@ -1,6 +1,5 @@ - process BUSCO { + process BUSCO_BUSCO { - tag "$meta.id" - label 'process_medium' + tag "${meta.id}_${lineage}" diff --git a/modules/nf-core/busco/environment.yml b/modules/nf-core/busco/busco/environment.yml similarity index 50% rename from modules/nf-core/busco/environment.yml rename to modules/nf-core/busco/busco/environment.yml index f872d057..5b918b45 100644 --- a/modules/nf-core/busco/environment.yml +++ b/modules/nf-core/busco/busco/environment.yml @@ -1,7 +1,5 @@ -name: busco channels: - conda-forge - bioconda - - defaults dependencies: - - bioconda::busco=5.5.0 + - bioconda::busco=5.7.1 diff --git a/modules/nf-core/busco/main.nf b/modules/nf-core/busco/busco/main.nf similarity index 80% rename from modules/nf-core/busco/main.nf rename to modules/nf-core/busco/busco/main.nf index 83d8eacd..319f7235 100644 --- a/modules/nf-core/busco/main.nf +++ b/modules/nf-core/busco/busco/main.nf @@ -1,13 +1,13 @@ -process BUSCO { +process BUSCO_BUSCO { tag "${meta.id}_${lineage}" conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/busco:5.5.0--pyhdfd78af_0': - 'biocontainers/busco:5.5.0--pyhdfd78af_0' }" + 'https://depot.galaxyproject.org/singularity/busco:5.7.1--pyhdfd78af_0': + 'biocontainers/busco:5.7.1--pyhdfd78af_0' }" input: - tuple val(meta), path('tmp_input/*') + tuple val(meta), path(fasta, stageAs:'tmp_input/*') val mode // Required: One of genome, proteins, or transcriptome val lineage // Required: lineage to check against, "auto" enables --auto-lineage instead path busco_lineages_path // Recommended: path to busco lineages - downloads if not set @@ -15,13 +15,13 @@ process BUSCO { output: tuple val(meta), path("*-busco.batch_summary.txt") , emit: batch_summary - tuple val(meta), path("short_summary.*.txt") , emit: short_summaries_txt, optional: true - tuple val(meta), path("short_summary.*.json") , emit: short_summaries_json, optional: true - tuple val(meta), path("*-busco/*/run_*/full_table.tsv") , emit: full_table, optional: true - tuple val(meta), path("*-busco/*/run_*/missing_busco_list.tsv") , emit: missing_busco_list, optional: true - tuple val(meta), path("*-busco/*/run_*/single_copy_proteins.faa") , emit: single_copy_proteins, optional: true + tuple val(meta), path("short_summary.*.txt") , emit: short_summaries_txt , optional: true + tuple val(meta), path("short_summary.*.json") , emit: short_summaries_json , optional: true + tuple val(meta), path("*-busco/*/run_*/full_table.tsv") , emit: full_table , optional: true + tuple val(meta), path("*-busco/*/run_*/missing_busco_list.tsv") , emit: missing_busco_list , optional: true + tuple val(meta), path("*-busco/*/run_*/single_copy_proteins.faa") , emit: single_copy_proteins , optional: true tuple val(meta), path("*-busco/*/run_*/busco_sequences") , emit: seq_dir - tuple val(meta), path("*-busco/*/translated_proteins") , emit: translated_dir, optional: true + tuple val(meta), path("*-busco/*/translated_proteins") , emit: translated_dir , optional: true tuple val(meta), path("*-busco") , emit: busco_dir path "versions.yml" , emit: versions @@ -90,4 +90,17 @@ process BUSCO { busco: \$( busco --version 2>&1 | sed 's/^BUSCO //' ) END_VERSIONS """ + + stub: + def prefix = task.ext.prefix ?: "${meta.id}-${lineage}" + def fasta_name = files(fasta).first().name - '.gz' + """ + touch ${prefix}-busco.batch_summary.txt + mkdir -p ${prefix}-busco/$fasta_name/run_${lineage}/busco_sequences + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + busco: \$( busco --version 2>&1 | sed 's/^BUSCO //' ) + END_VERSIONS + """ } diff --git a/modules/nf-core/busco/busco/meta.yml b/modules/nf-core/busco/busco/meta.yml new file mode 100644 index 00000000..7cb6d69c --- /dev/null +++ b/modules/nf-core/busco/busco/meta.yml @@ -0,0 +1,152 @@ +name: busco_busco +description: Benchmarking Universal Single Copy Orthologs +keywords: + - quality control + - genome + - transcriptome + - proteome +tools: + - busco: + description: BUSCO provides measures for quantitative assessment of genome assembly, + gene set, and transcriptome completeness based on evolutionarily informed expectations + of gene content from near-universal single-copy orthologs selected from OrthoDB. + homepage: https://busco.ezlab.org/ + documentation: https://busco.ezlab.org/busco_userguide.html + tool_dev_url: https://gitlab.com/ezlab/busco + doi: "10.1007/978-1-4939-9173-0_14" + licence: ["MIT"] + identifier: biotools:busco +input: + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - fasta: + type: file + description: Nucleic or amino acid sequence file in FASTA format. + pattern: "*.{fasta,fna,fa,fasta.gz,fna.gz,fa.gz}" + - - mode: + type: string + description: The mode to run Busco in. One of genome, proteins, or transcriptome + pattern: "{genome,proteins,transcriptome}" + - - lineage: + type: string + description: The BUSCO lineage to use, or "auto" to automatically select lineage + - - busco_lineages_path: + type: directory + description: Path to local BUSCO lineages directory. + - - config_file: + type: file + description: Path to BUSCO config file. +output: + - batch_summary: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*-busco.batch_summary.txt": + type: file + description: Summary of all sequence files analyzed + pattern: "*-busco.batch_summary.txt" + - short_summaries_txt: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - short_summary.*.txt: + type: file + description: Short Busco summary in plain text format + pattern: "short_summary.*.txt" + - short_summaries_json: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - short_summary.*.json: + type: file + description: Short Busco summary in JSON format + pattern: "short_summary.*.json" + - full_table: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*-busco/*/run_*/full_table.tsv": + type: file + description: Full BUSCO results table + pattern: "full_table.tsv" + - missing_busco_list: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*-busco/*/run_*/missing_busco_list.tsv": + type: file + description: List of missing BUSCOs + pattern: "missing_busco_list.tsv" + - single_copy_proteins: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*-busco/*/run_*/single_copy_proteins.faa": + type: file + description: Fasta file of single copy proteins (transcriptome mode) + pattern: "single_copy_proteins.faa" + - seq_dir: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*-busco/*/run_*/busco_sequences": + type: directory + description: BUSCO sequence directory + pattern: "busco_sequences" + - translated_dir: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*-busco/*/translated_proteins": + type: directory + description: Six frame translations of each transcript made by the transcriptome + mode + pattern: "translated_dir" + - busco_dir: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*-busco": + type: directory + description: BUSCO lineage specific output + pattern: "*-busco" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" +authors: + - "@priyanka-surana" + - "@charles-plessy" + - "@mahesh-panchal" + - "@muffato" + - "@jvhagey" + - "@gallvp" +maintainers: + - "@priyanka-surana" + - "@charles-plessy" + - "@mahesh-panchal" + - "@muffato" + - "@jvhagey" + - "@gallvp" diff --git a/modules/nf-core/busco/busco/tests/main.nf.test b/modules/nf-core/busco/busco/tests/main.nf.test new file mode 100644 index 00000000..bb7b49a9 --- /dev/null +++ b/modules/nf-core/busco/busco/tests/main.nf.test @@ -0,0 +1,415 @@ +nextflow_process { + + name "Test Process BUSCO_BUSCO" + script "../main.nf" + process "BUSCO_BUSCO" + + tag "modules" + tag "modules_nfcore" + tag "busco" + tag "busco/busco" + + test("test_busco_genome_single_fasta") { + + config './nextflow.config' + + when { + process { + """ + input[0] = [ + [ id:'test' ], // meta map + file(params.modules_testdata_base_path + 'genomics/prokaryotes/bacteroides_fragilis/genome/genome.fna.gz', checkIfExists: true) + ] + input[1] = 'genome' + input[2] = 'bacteria_odb10' // Launch with 'auto' to use --auto-lineage, and specified lineages // 'auto' removed from test due to memory issues + input[3] = [] // Download busco lineage + input[4] = [] // No config + """ + } + } + + then { + assert process.success + + with(path(process.out.short_summaries_txt[0][1]).text) { + assert contains('BUSCO version') + assert contains('The lineage dataset is') + assert contains('BUSCO was run in mode') + assert contains('Complete BUSCOs') + assert contains('Missing BUSCOs') + assert contains('Dependencies and versions') + } + + with(path(process.out.short_summaries_json[0][1]).text) { + assert contains('one_line_summary') + assert contains('mode') + assert contains('dataset') + } + + assert snapshot( + process.out.batch_summary[0][1], + process.out.full_table[0][1], + process.out.missing_busco_list[0][1], + process.out.versions[0] + ).match() + + with(file(process.out.seq_dir[0][1]).listFiles().collect { it.name }) { + assert contains('single_copy_busco_sequences.tar.gz') + assert contains('multi_copy_busco_sequences.tar.gz') + assert contains('fragmented_busco_sequences.tar.gz') + } + + with(path("${process.out.busco_dir[0][1]}/logs/busco.log").text) { + assert contains('DEBUG:busco.run_BUSCO') + assert contains('Results from dataset') + assert contains('how to cite BUSCO') + } + + assert process.out.single_copy_proteins == [] + assert process.out.translated_dir == [] + } + } + + test("test_busco_genome_multi_fasta") { + + config './nextflow.config' + + when { + process { + """ + input[0] = [ + [ id:'test' ], // meta map + [ + file(params.modules_testdata_base_path + 'genomics/prokaryotes/bacteroides_fragilis/genome/genome.fna.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/prokaryotes/candidatus_portiera_aleyrodidarum/genome/genome.fasta', checkIfExists: true) + ] + ] + input[1] = 'genome' + input[2] = 'bacteria_odb10' + input[3] = [] + input[4] = [] + """ + } + } + + then { + assert process.success + + with(path(process.out.short_summaries_txt[0][1][0]).text) { + assert contains('BUSCO version') + assert contains('The lineage dataset is') + assert contains('BUSCO was run in mode') + assert contains('Complete BUSCOs') + assert contains('Missing BUSCOs') + assert contains('Dependencies and versions') + } + + with(path(process.out.short_summaries_txt[0][1][1]).text) { + assert contains('BUSCO version') + assert contains('The lineage dataset is') + assert contains('BUSCO was run in mode') + assert contains('Complete BUSCOs') + assert contains('Missing BUSCOs') + assert contains('Dependencies and versions') + } + + with(path(process.out.short_summaries_json[0][1][0]).text) { + assert contains('one_line_summary') + assert contains('mode') + assert contains('dataset') + } + + with(path(process.out.short_summaries_json[0][1][1]).text) { + assert contains('one_line_summary') + assert contains('mode') + assert contains('dataset') + } + + assert snapshot( + process.out.batch_summary[0][1], + process.out.full_table[0][1], + process.out.missing_busco_list[0][1], + process.out.versions[0] + ).match() + + with(file(process.out.seq_dir[0][1][0]).listFiles().collect { it.name }) { + assert contains('single_copy_busco_sequences.tar.gz') + assert contains('multi_copy_busco_sequences.tar.gz') + assert contains('fragmented_busco_sequences.tar.gz') + } + + with(file(process.out.seq_dir[0][1][1]).listFiles().collect { it.name }) { + assert contains('single_copy_busco_sequences.tar.gz') + assert contains('multi_copy_busco_sequences.tar.gz') + assert contains('fragmented_busco_sequences.tar.gz') + } + + with(path("${process.out.busco_dir[0][1]}/logs/busco.log").text) { + assert contains('DEBUG:busco.run_BUSCO') + assert contains('Results from dataset') + assert contains('how to cite BUSCO') + } + + assert process.out.single_copy_proteins == [] + assert process.out.translated_dir == [] + } + + } + + test("test_busco_eukaryote_metaeuk") { + + config './nextflow.metaeuk.config' + + when { + process { + """ + input[0] = [ + [ id:'test' ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) + ] + input[1] = 'genome' + input[2] = 'eukaryota_odb10' + input[3] = [] + input[4] = [] + """ + } + } + + then { + assert process.success + + with(path(process.out.short_summaries_txt[0][1]).text) { + assert contains('BUSCO version') + assert contains('The lineage dataset is') + assert contains('BUSCO was run in mode') + assert contains('Complete BUSCOs') + assert contains('Missing BUSCOs') + assert contains('Dependencies and versions') + } + + with(path(process.out.short_summaries_json[0][1]).text) { + assert contains('one_line_summary') + assert contains('mode') + assert contains('dataset') + } + + assert snapshot( + process.out.batch_summary[0][1], + process.out.full_table[0][1], + process.out.missing_busco_list[0][1], + process.out.versions[0] + ).match() + + with(file(process.out.seq_dir[0][1]).listFiles().collect { it.name }) { + assert contains('single_copy_busco_sequences.tar.gz') + assert contains('multi_copy_busco_sequences.tar.gz') + assert contains('fragmented_busco_sequences.tar.gz') + } + + with(path("${process.out.busco_dir[0][1]}/logs/busco.log").text) { + assert contains('DEBUG:busco.run_BUSCO') + assert contains('Results from dataset') + assert contains('how to cite BUSCO') + + } + + assert process.out.single_copy_proteins == [] + assert process.out.translated_dir == [] + } + + } + + test("test_busco_eukaryote_augustus") { + + config './nextflow.augustus.config' + + when { + process { + """ + input[0] = [ + [ id:'test' ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) + ] + input[1] = 'genome' + input[2] = 'eukaryota_odb10' + input[3] = [] + input[4] = [] + """ + } + } + + then { + assert process.success + + assert snapshot( + process.out.batch_summary[0][1], + process.out.versions[0] + ).match() + + with(path("${process.out.busco_dir[0][1]}/logs/busco.log").text) { + assert contains('DEBUG:busco.run_BUSCO') + assert contains('Augustus did not recognize any genes') + + } + + assert process.out.short_summaries_json == [] + assert process.out.short_summaries_txt == [] + assert process.out.missing_busco_list == [] + assert process.out.full_table == [] + assert process.out.single_copy_proteins == [] + assert process.out.translated_dir == [] + } + + } + + test("test_busco_protein") { + + config './nextflow.config' + + when { + process { + """ + input[0] = [ + [ id:'test' ], // meta map + file(params.modules_testdata_base_path + 'genomics/prokaryotes/candidatus_portiera_aleyrodidarum/genome/proteome.fasta', checkIfExists: true) + ] + input[1] = 'proteins' + input[2] = 'bacteria_odb10' + input[3] = [] + input[4] = [] + """ + } + } + + then { + assert process.success + + with(path(process.out.short_summaries_txt[0][1]).text) { + assert contains('BUSCO version') + assert contains('The lineage dataset is') + assert contains('BUSCO was run in mode') + assert contains('Complete BUSCOs') + assert contains('Missing BUSCOs') + assert contains('Dependencies and versions') + } + + with(path(process.out.short_summaries_json[0][1]).text) { + assert contains('one_line_summary') + assert contains('mode') + assert contains('dataset') + } + + assert snapshot( + process.out.batch_summary[0][1], + process.out.full_table[0][1], + process.out.missing_busco_list[0][1], + process.out.versions[0] + ).match() + + with(file(process.out.seq_dir[0][1]).listFiles().collect { it.name }) { + assert contains('single_copy_busco_sequences.tar.gz') + assert contains('multi_copy_busco_sequences.tar.gz') + assert contains('fragmented_busco_sequences.tar.gz') + } + + with(path("${process.out.busco_dir[0][1]}/logs/busco.log").text) { + assert contains('DEBUG:busco.run_BUSCO') + assert contains('Results from dataset') + assert contains('how to cite BUSCO') + } + + assert process.out.single_copy_proteins == [] + assert process.out.translated_dir == [] + } + + } + + test("test_busco_transcriptome") { + + config './nextflow.config' + + when { + process { + """ + input[0] = [ + [ id:'test' ], // meta map + file(params.modules_testdata_base_path + 'genomics/prokaryotes/bacteroides_fragilis/illumina/fasta/test1.contigs.fa.gz', checkIfExists: true) + ] + input[1] = 'transcriptome' + input[2] = 'bacteria_odb10' + input[3] = [] + input[4] = [] + """ + } + } + + then { + assert process.success + + with(path(process.out.short_summaries_txt[0][1]).text) { + assert contains('BUSCO version') + assert contains('The lineage dataset is') + assert contains('BUSCO was run in mode') + assert contains('Complete BUSCOs') + assert contains('Missing BUSCOs') + assert contains('Dependencies and versions') + } + + with(path(process.out.short_summaries_json[0][1]).text) { + assert contains('one_line_summary') + assert contains('mode') + assert contains('dataset') + } + + assert snapshot( + process.out.batch_summary[0][1], + process.out.full_table[0][1], + process.out.missing_busco_list[0][1], + process.out.translated_dir[0][1], + process.out.single_copy_proteins[0][1], + process.out.versions[0] + ).match() + + with(file(process.out.seq_dir[0][1]).listFiles().collect { it.name }) { + assert contains('single_copy_busco_sequences.tar.gz') + assert contains('multi_copy_busco_sequences.tar.gz') + assert contains('fragmented_busco_sequences.tar.gz') + } + + with(path("${process.out.busco_dir[0][1]}/logs/busco.log").text) { + assert contains('DEBUG:busco.run_BUSCO') + assert contains('Results from dataset') + assert contains('how to cite BUSCO') + } + } + + } + + test("minimal-stub") { + + options '-stub' + + when { + process { + """ + input[0] = [ + [ id:'test' ], // meta map + file(params.modules_testdata_base_path + 'genomics/prokaryotes/bacteroides_fragilis/genome/genome.fna.gz', checkIfExists: true) + ] + input[1] = 'genome' + input[2] = 'bacteria_odb10' + input[3] = [] + input[4] = [] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + +} diff --git a/modules/nf-core/busco/busco/tests/main.nf.test.snap b/modules/nf-core/busco/busco/tests/main.nf.test.snap new file mode 100644 index 00000000..1b6411bc --- /dev/null +++ b/modules/nf-core/busco/busco/tests/main.nf.test.snap @@ -0,0 +1,230 @@ +{ + "minimal-stub": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test-bacteria_odb10-busco.batch_summary.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + + ], + "2": [ + + ], + "3": [ + + ], + "4": [ + + ], + "5": [ + + ], + "6": [ + [ + { + "id": "test" + }, + [ + + ] + ] + ], + "7": [ + + ], + "8": [ + [ + { + "id": "test" + }, + [ + [ + [ + [ + + ] + ] + ] + ] + ] + ], + "9": [ + "versions.yml:md5,3fc94714b95c2dc15399a4229d9dd1d9" + ], + "batch_summary": [ + [ + { + "id": "test" + }, + "test-bacteria_odb10-busco.batch_summary.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "busco_dir": [ + [ + { + "id": "test" + }, + [ + [ + [ + [ + + ] + ] + ] + ] + ] + ], + "full_table": [ + + ], + "missing_busco_list": [ + + ], + "seq_dir": [ + [ + { + "id": "test" + }, + [ + + ] + ] + ], + "short_summaries_json": [ + + ], + "short_summaries_txt": [ + + ], + "single_copy_proteins": [ + + ], + "translated_dir": [ + + ], + "versions": [ + "versions.yml:md5,3fc94714b95c2dc15399a4229d9dd1d9" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-05-03T13:28:04.451297" + }, + "test_busco_eukaryote_augustus": { + "content": [ + "test-eukaryota_odb10-busco.batch_summary.txt:md5,3ea3bdc423a461dae514d816bdc61c89", + "versions.yml:md5,3fc94714b95c2dc15399a4229d9dd1d9" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-05-03T13:26:36.974986" + }, + "test_busco_genome_single_fasta": { + "content": [ + "test-bacteria_odb10-busco.batch_summary.txt:md5,21b3fb771cf36be917cc451540d999be", + "full_table.tsv:md5,638fe7590f442c57361554dae330eca1", + "missing_busco_list.tsv:md5,1530af4fe7673a6d001349537bcd410a", + "versions.yml:md5,3fc94714b95c2dc15399a4229d9dd1d9" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-05-03T13:22:45.07816" + }, + "test_busco_genome_multi_fasta": { + "content": [ + "test-bacteria_odb10-busco.batch_summary.txt:md5,fcd3c208913e8abda3d6742c43fec5fa", + [ + "full_table.tsv:md5,c657edcc7d0de0175869717551df6e83", + "full_table.tsv:md5,638fe7590f442c57361554dae330eca1" + ], + [ + "missing_busco_list.tsv:md5,aceb66e347a353cb7fca8e2a725f9112", + "missing_busco_list.tsv:md5,1530af4fe7673a6d001349537bcd410a" + ], + "versions.yml:md5,3fc94714b95c2dc15399a4229d9dd1d9" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-05-03T13:23:50.255602" + }, + "test_busco_eukaryote_metaeuk": { + "content": [ + "test-eukaryota_odb10-busco.batch_summary.txt:md5,ff6d8277e452a83ce9456bbee666feb6", + "full_table.tsv:md5,92b1b1d5cb5ea0e2093d16f00187e8c7", + "missing_busco_list.tsv:md5,0352e563de290bf804c708323c35a9e3", + "versions.yml:md5,3fc94714b95c2dc15399a4229d9dd1d9" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-05-03T13:25:38.159041" + }, + "test_busco_transcriptome": { + "content": [ + "test-bacteria_odb10-busco.batch_summary.txt:md5,8734b3f379c4c0928e5dd4ea1873dc64", + "full_table.tsv:md5,1b2ce808fdafa744c56b5f781551272d", + "missing_busco_list.tsv:md5,a6931b6470262b997b8b99ea0f1d14a4", + [ + "1024388at2.faa:md5,797d603d262a6595a112e25b73e878b0", + "1054741at2.faa:md5,cd4b928cba6b19b4437746ba507e7195", + "1093223at2.faa:md5,df9549708e5ffcfaee6a74dd70a0e5dc", + "1151822at2.faa:md5,12726afc1cdc40c13392e1596e93df3a", + "143460at2.faa:md5,d887431fd988a5556a523440f02d9594", + "1491686at2.faa:md5,d03362d19979b27306c192f1c74a84e5", + "1504821at2.faa:md5,4f5f6e5c57bac0092c1d85ded73d7e67", + "1574817at2.faa:md5,1153e55998c2929eacad2aed7d08d248", + "1592033at2.faa:md5,bb7a59e5f3a57ba12d10dabf4c77ab57", + "1623045at2.faa:md5,8fe38155feb1802beb97ef7714837bf5", + "1661836at2.faa:md5,6c6d592c2fbb0d7a4e5e1f47a15644f0", + "1674344at2.faa:md5,bb41b44e53565a54cadf0b780532fe08", + "1698718at2.faa:md5,f233860000028eb00329aa85236c71e5", + "1990650at2.faa:md5,34a2d29c5f8b6253159ddb7a43fa1829", + "223233at2.faa:md5,dec6705c7846c989296e73942f953cbc", + "402899at2.faa:md5,acc0f271f9a586d2ce1ee41669b22999", + "505485at2.faa:md5,aa0391f8fa5d9bd19b30d844d5a99845", + "665824at2.faa:md5,47f8ad43b6a6078206feb48c2e552793", + "776861at2.faa:md5,f8b90c13f7c6be828dea3bb920195e3d", + "874197at2.faa:md5,8d22a35a768debe6f376fc695d233a69", + "932854at2.faa:md5,2eff2de1ab83b22f3234a529a44e22bb", + "95696at2.faa:md5,247bfd1aef432f7b5456307768e9149c" + ], + "single_copy_proteins.faa:md5,73e2c5d6a9b0f01f2deea3cc5f21b764", + "versions.yml:md5,3fc94714b95c2dc15399a4229d9dd1d9" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-05-03T13:27:53.992893" + }, + "test_busco_protein": { + "content": [ + "test-bacteria_odb10-busco.batch_summary.txt:md5,f5a782378f9f94a748aa907381fdef91", + "full_table.tsv:md5,812ab6a0496fccab774643cf40c4f2a8", + "missing_busco_list.tsv:md5,aceb66e347a353cb7fca8e2a725f9112", + "versions.yml:md5,3fc94714b95c2dc15399a4229d9dd1d9" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-05-03T13:27:12.724862" + } +} \ No newline at end of file diff --git a/modules/nf-core/busco/busco/tests/nextflow.augustus.config b/modules/nf-core/busco/busco/tests/nextflow.augustus.config new file mode 100644 index 00000000..84daa69d --- /dev/null +++ b/modules/nf-core/busco/busco/tests/nextflow.augustus.config @@ -0,0 +1,5 @@ +process { + withName: 'BUSCO_BUSCO' { + ext.args = '--tar --augustus' + } +} diff --git a/modules/nf-core/busco/busco/tests/nextflow.config b/modules/nf-core/busco/busco/tests/nextflow.config new file mode 100644 index 00000000..1ec3fec0 --- /dev/null +++ b/modules/nf-core/busco/busco/tests/nextflow.config @@ -0,0 +1,5 @@ +process { + withName: 'BUSCO_BUSCO' { + ext.args = '--tar' + } +} diff --git a/modules/nf-core/busco/busco/tests/nextflow.metaeuk.config b/modules/nf-core/busco/busco/tests/nextflow.metaeuk.config new file mode 100644 index 00000000..c1418445 --- /dev/null +++ b/modules/nf-core/busco/busco/tests/nextflow.metaeuk.config @@ -0,0 +1,5 @@ +process { + withName: 'BUSCO_BUSCO' { + ext.args = '--tar --metaeuk' + } +} diff --git a/modules/nf-core/busco/busco/tests/old_test.yml b/modules/nf-core/busco/busco/tests/old_test.yml new file mode 100644 index 00000000..75177f5d --- /dev/null +++ b/modules/nf-core/busco/busco/tests/old_test.yml @@ -0,0 +1,624 @@ +- name: busco test_busco_genome_single_fasta + command: nextflow run ./tests/modules/nf-core/busco -entry test_busco_genome_single_fasta -c ./tests/config/nextflow.config + tags: + - busco + files: + - path: output/busco/short_summary.specific.bacteria_odb10.genome.fna.json + contains: + - "one_line_summary" + - "mode" + - "dataset" + - path: output/busco/short_summary.specific.bacteria_odb10.genome.fna.txt + contains: + - "BUSCO version" + - "The lineage dataset is" + - "BUSCO was run in mode" + - "Complete BUSCOs" + - "Missing BUSCOs" + - "Dependencies and versions" + - path: output/busco/test-bacteria_odb10-busco.batch_summary.txt + md5sum: bc2440f8a68d7fbf931ff911c1c3fdfa + - path: output/busco/test-bacteria_odb10-busco/genome.fna/logs/bbtools_err.log + - path: output/busco/test-bacteria_odb10-busco/genome.fna/logs/bbtools_out.log + md5sum: 9caf1a1434414c78562eb0bbb9c0e53f + - path: output/busco/test-bacteria_odb10-busco/genome.fna/logs/hmmsearch_err.log + - path: output/busco/test-bacteria_odb10-busco/genome.fna/logs/hmmsearch_out.log + contains: + - "# hmmsearch :: search profile(s) against a sequence database" + - "# target sequence database:" + - "Internal pipeline statistics summary:" + - "[ok]" + - path: output/busco/test-bacteria_odb10-busco/genome.fna/logs/prodigal_err.log + md5sum: 538510cfc7483498210f01e53fe035ad + - path: output/busco/test-bacteria_odb10-busco/genome.fna/logs/prodigal_out.log + md5sum: 61050b0706addc9498b2088a2d6efa9a + - path: output/busco/test-bacteria_odb10-busco/genome.fna/prodigal_output/.checkpoint + contains: + - "Tool: prodigal" + - "Completed" + - "jobs" + - path: output/busco/test-bacteria_odb10-busco/genome.fna/prodigal_output/predicted_genes/predicted.faa + md5sum: 836e9a80d33d8b89168f07ddc13ee991 + - path: output/busco/test-bacteria_odb10-busco/genome.fna/prodigal_output/predicted_genes/predicted.fna + md5sum: 20eeb75f86842e6e136f02bca8b73a9f + - path: output/busco/test-bacteria_odb10-busco/genome.fna/prodigal_output/predicted_genes/tmp/prodigal_mode_single_code_11.faa + md5sum: 836e9a80d33d8b89168f07ddc13ee991 + - path: output/busco/test-bacteria_odb10-busco/genome.fna/prodigal_output/predicted_genes/tmp/prodigal_mode_single_code_11.fna + md5sum: 20eeb75f86842e6e136f02bca8b73a9f + - path: output/busco/test-bacteria_odb10-busco/genome.fna/prodigal_output/predicted_genes/tmp/prodigal_mode_single_code_11_err.log + md5sum: 538510cfc7483498210f01e53fe035ad + - path: output/busco/test-bacteria_odb10-busco/genome.fna/prodigal_output/predicted_genes/tmp/prodigal_mode_single_code_11_out.log + md5sum: 61050b0706addc9498b2088a2d6efa9a + - path: output/busco/test-bacteria_odb10-busco/genome.fna/run_bacteria_odb10/.bbtools_output/.checkpoint + contains: + - "Tool: bbtools" + - "Completed" + - "jobs" + - path: output/busco/test-bacteria_odb10-busco/genome.fna/run_bacteria_odb10/busco_sequences/fragmented_busco_sequences.tar.gz + - path: output/busco/test-bacteria_odb10-busco/genome.fna/run_bacteria_odb10/busco_sequences/multi_copy_busco_sequences.tar.gz + - path: output/busco/test-bacteria_odb10-busco/genome.fna/run_bacteria_odb10/busco_sequences/single_copy_busco_sequences.tar.gz + - path: output/busco/test-bacteria_odb10-busco/genome.fna/run_bacteria_odb10/full_table.tsv + md5sum: c56edab1dc1522e993c25ae2b730799f + - path: output/busco/test-bacteria_odb10-busco/genome.fna/run_bacteria_odb10/hmmer_output.tar.gz + - path: output/busco/test-bacteria_odb10-busco/genome.fna/run_bacteria_odb10/missing_busco_list.tsv + md5sum: b533ef30270f27160acce85a22d01bf5 + - path: output/busco/test-bacteria_odb10-busco/genome.fna/run_bacteria_odb10/short_summary.json + contains: + - "one_line_summary" + - "mode" + - "lineage_dataset" + - path: output/busco/test-bacteria_odb10-busco/genome.fna/run_bacteria_odb10/short_summary.txt + contains: + - "# BUSCO version is:" + - "Results:" + - "busco:" + - path: output/busco/test-bacteria_odb10-busco/logs/busco.log + contains: + - "DEBUG:busco.run_BUSCO" + - "Results from dataset" + - "how to cite BUSCO" + - path: output/busco/versions.yml + +- name: busco test_busco_genome_multi_fasta + command: nextflow run ./tests/modules/nf-core/busco -entry test_busco_genome_multi_fasta -c ./tests/config/nextflow.config + tags: + - busco + files: + - path: output/busco/short_summary.specific.bacteria_odb10.genome.fasta.json + contains: + - "one_line_summary" + - "mode" + - "dataset" + - path: output/busco/short_summary.specific.bacteria_odb10.genome.fasta.txt + contains: + - "BUSCO version" + - "The lineage dataset is" + - "BUSCO was run in mode" + - "Complete BUSCOs" + - "Missing BUSCOs" + - "Dependencies and versions" + - path: output/busco/short_summary.specific.bacteria_odb10.genome.fna.json + contains: + - "one_line_summary" + - "mode" + - "dataset" + - path: output/busco/short_summary.specific.bacteria_odb10.genome.fna.txt + contains: + - "BUSCO version" + - "The lineage dataset is" + - "BUSCO was run in mode" + - "Complete BUSCOs" + - "Missing BUSCOs" + - "Dependencies and versions" + - path: output/busco/test-bacteria_odb10-busco.batch_summary.txt + md5sum: 8c64c1a28b086ef2ee444f99cbed5f7d + - path: output/busco/test-bacteria_odb10-busco/genome.fasta/logs/bbtools_err.log + - path: output/busco/test-bacteria_odb10-busco/genome.fasta/logs/bbtools_out.log + md5sum: 8f047bdb33264d22a83920bc2c63f29a + - path: output/busco/test-bacteria_odb10-busco/genome.fasta/logs/hmmsearch_err.log + - path: output/busco/test-bacteria_odb10-busco/genome.fasta/logs/hmmsearch_out.log + contains: + - "# hmmsearch :: search profile(s) against a sequence database" + - "# target sequence database:" + - "Internal pipeline statistics summary:" + - "[ok]" + - path: output/busco/test-bacteria_odb10-busco/genome.fasta/logs/prodigal_err.log + md5sum: c1fdc6977332f53dfe7f632733bb4585 + - path: output/busco/test-bacteria_odb10-busco/genome.fasta/logs/prodigal_out.log + md5sum: 50752acb1c5a20be886bfdfc06635bcb + - path: output/busco/test-bacteria_odb10-busco/genome.fasta/prodigal_output/.checkpoint + contains: + - "Tool: prodigal" + - "Completed" + - "jobs" + - path: output/busco/test-bacteria_odb10-busco/genome.fasta/prodigal_output/predicted_genes/predicted.faa + md5sum: 8166471fc5f08c82fd5643ab42327f9d + - path: output/busco/test-bacteria_odb10-busco/genome.fasta/prodigal_output/predicted_genes/predicted.fna + md5sum: ddc508a18f60e7f3314534df50cdf8ca + - path: output/busco/test-bacteria_odb10-busco/genome.fasta/prodigal_output/predicted_genes/tmp/prodigal_mode_single_code_11.faa + md5sum: 8166471fc5f08c82fd5643ab42327f9d + - path: output/busco/test-bacteria_odb10-busco/genome.fasta/prodigal_output/predicted_genes/tmp/prodigal_mode_single_code_11.fna + md5sum: ddc508a18f60e7f3314534df50cdf8ca + - path: output/busco/test-bacteria_odb10-busco/genome.fasta/prodigal_output/predicted_genes/tmp/prodigal_mode_single_code_11_err.log + md5sum: c1fdc6977332f53dfe7f632733bb4585 + - path: output/busco/test-bacteria_odb10-busco/genome.fasta/prodigal_output/predicted_genes/tmp/prodigal_mode_single_code_11_out.log + md5sum: 50752acb1c5a20be886bfdfc06635bcb + - path: output/busco/test-bacteria_odb10-busco/genome.fasta/prodigal_output/predicted_genes/tmp/prodigal_mode_single_code_4.faa + md5sum: e56fd59c38248dc21ac94355dca98121 + - path: output/busco/test-bacteria_odb10-busco/genome.fasta/prodigal_output/predicted_genes/tmp/prodigal_mode_single_code_4.fna + md5sum: b365f84bf99c68357952e0b98ed7ce42 + - path: output/busco/test-bacteria_odb10-busco/genome.fasta/prodigal_output/predicted_genes/tmp/prodigal_mode_single_code_4_err.log + md5sum: e5f14d7925ba14a0f9850542f3739894 + - path: output/busco/test-bacteria_odb10-busco/genome.fasta/prodigal_output/predicted_genes/tmp/prodigal_mode_single_code_4_out.log + md5sum: d41971bfc1b621d4ffd2633bc47017ea + - path: output/busco/test-bacteria_odb10-busco/genome.fasta/run_bacteria_odb10/.bbtools_output/.checkpoint + contains: + - "Tool: bbtools" + - "Completed" + - "jobs" + - path: output/busco/test-bacteria_odb10-busco/genome.fasta/run_bacteria_odb10/busco_sequences/fragmented_busco_sequences.tar.gz + - path: output/busco/test-bacteria_odb10-busco/genome.fasta/run_bacteria_odb10/busco_sequences/multi_copy_busco_sequences.tar.gz + - path: output/busco/test-bacteria_odb10-busco/genome.fasta/run_bacteria_odb10/busco_sequences/single_copy_busco_sequences.tar.gz + - path: output/busco/test-bacteria_odb10-busco/genome.fasta/run_bacteria_odb10/full_table.tsv + md5sum: c9651b88b10871abc260ee655898e828 + - path: output/busco/test-bacteria_odb10-busco/genome.fasta/run_bacteria_odb10/hmmer_output.tar.gz + - path: output/busco/test-bacteria_odb10-busco/genome.fasta/run_bacteria_odb10/missing_busco_list.tsv + md5sum: 9939309df2da5419de88c32d1435c779 + - path: output/busco/test-bacteria_odb10-busco/genome.fasta/run_bacteria_odb10/short_summary.json + contains: + - "one_line_summary" + - "mode" + - "dataset" + - path: output/busco/test-bacteria_odb10-busco/genome.fasta/run_bacteria_odb10/short_summary.txt + contains: + - "# BUSCO version is:" + - "Results:" + - "busco:" + - path: output/busco/test-bacteria_odb10-busco/genome.fna/logs/bbtools_err.log + - path: output/busco/test-bacteria_odb10-busco/genome.fna/logs/bbtools_out.log + md5sum: 9caf1a1434414c78562eb0bbb9c0e53f + - path: output/busco/test-bacteria_odb10-busco/genome.fna/logs/hmmsearch_err.log + - path: output/busco/test-bacteria_odb10-busco/genome.fna/logs/hmmsearch_out.log + contains: + - "# hmmsearch :: search profile(s) against a sequence database" + - "# target sequence database:" + - "Internal pipeline statistics summary:" + - "[ok]" + - path: output/busco/test-bacteria_odb10-busco/genome.fna/logs/prodigal_err.log + md5sum: 538510cfc7483498210f01e53fe035ad + - path: output/busco/test-bacteria_odb10-busco/genome.fna/logs/prodigal_out.log + md5sum: 61050b0706addc9498b2088a2d6efa9a + - path: output/busco/test-bacteria_odb10-busco/genome.fna/prodigal_output/.checkpoint + contains: + - "Tool: prodigal" + - "Completed" + - "jobs" + - path: output/busco/test-bacteria_odb10-busco/genome.fna/prodigal_output/predicted_genes/predicted.faa + md5sum: 836e9a80d33d8b89168f07ddc13ee991 + - path: output/busco/test-bacteria_odb10-busco/genome.fna/prodigal_output/predicted_genes/predicted.fna + md5sum: 20eeb75f86842e6e136f02bca8b73a9f + - path: output/busco/test-bacteria_odb10-busco/genome.fna/prodigal_output/predicted_genes/tmp/prodigal_mode_single_code_11.faa + md5sum: 836e9a80d33d8b89168f07ddc13ee991 + - path: output/busco/test-bacteria_odb10-busco/genome.fna/prodigal_output/predicted_genes/tmp/prodigal_mode_single_code_11.fna + md5sum: 20eeb75f86842e6e136f02bca8b73a9f + - path: output/busco/test-bacteria_odb10-busco/genome.fna/prodigal_output/predicted_genes/tmp/prodigal_mode_single_code_11_err.log + md5sum: 538510cfc7483498210f01e53fe035ad + - path: output/busco/test-bacteria_odb10-busco/genome.fna/prodigal_output/predicted_genes/tmp/prodigal_mode_single_code_11_out.log + md5sum: 61050b0706addc9498b2088a2d6efa9a + - path: output/busco/test-bacteria_odb10-busco/genome.fna/run_bacteria_odb10/.bbtools_output/.checkpoint + contains: + - "Tool: bbtools" + - "Completed" + - "jobs" + - path: output/busco/test-bacteria_odb10-busco/genome.fna/run_bacteria_odb10/busco_sequences/fragmented_busco_sequences.tar.gz + - path: output/busco/test-bacteria_odb10-busco/genome.fna/run_bacteria_odb10/busco_sequences/multi_copy_busco_sequences.tar.gz + - path: output/busco/test-bacteria_odb10-busco/genome.fna/run_bacteria_odb10/busco_sequences/single_copy_busco_sequences.tar.gz + - path: output/busco/test-bacteria_odb10-busco/genome.fna/run_bacteria_odb10/full_table.tsv + md5sum: c56edab1dc1522e993c25ae2b730799f + - path: output/busco/test-bacteria_odb10-busco/genome.fna/run_bacteria_odb10/hmmer_output.tar.gz + - path: output/busco/test-bacteria_odb10-busco/genome.fna/run_bacteria_odb10/missing_busco_list.tsv + md5sum: b533ef30270f27160acce85a22d01bf5 + - path: output/busco/test-bacteria_odb10-busco/genome.fna/run_bacteria_odb10/short_summary.json + contains: + - "one_line_summary" + - "mode" + - "dataset" + - path: output/busco/test-bacteria_odb10-busco/genome.fna/run_bacteria_odb10/short_summary.txt + contains: + - "# BUSCO version is:" + - "Results:" + - "busco:" + - path: output/busco/test-bacteria_odb10-busco/logs/busco.log + contains: + - "DEBUG:busco.run_BUSCO" + - "Results from dataset" + - "how to cite BUSCO" + - path: output/busco/versions.yml + +- name: busco test_busco_eukaryote_metaeuk + command: nextflow run ./tests/modules/nf-core/busco -entry test_busco_eukaryote_metaeuk -c ./tests/config/nextflow.config + tags: + - busco + files: + - path: output/busco/short_summary.specific.eukaryota_odb10.genome.fasta.json + contains: + - "one_line_summary" + - "mode" + - "dataset" + - path: output/busco/short_summary.specific.eukaryota_odb10.genome.fasta.txt + contains: + - "BUSCO version" + - "The lineage dataset is" + - "BUSCO was run in mode" + - "Complete BUSCOs" + - "Missing BUSCOs" + - "Dependencies and versions" + - path: output/busco/test-eukaryota_odb10-busco.batch_summary.txt + md5sum: ff6d8277e452a83ce9456bbee666feb6 + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/logs/bbtools_err.log + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/logs/bbtools_out.log + md5sum: e63debaa653f18f7405d936050abc093 + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/logs/hmmsearch_err.log + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/logs/hmmsearch_out.log + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/logs/metaeuk_run1_err.log + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/logs/metaeuk_run1_out.log + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/logs/metaeuk_run2_err.log + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/logs/metaeuk_run2_out.log + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/.bbtools_output/.checkpoint + contains: + - "Tool: bbtools" + - "Completed" + - "jobs" + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/busco_sequences/fragmented_busco_sequences.tar.gz + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/busco_sequences/multi_copy_busco_sequences.tar.gz + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/busco_sequences/single_copy_busco_sequences.tar.gz + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/full_table.tsv + md5sum: bd880e90b9e5620a58943a3e0f9ff16b + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/hmmer_output.tar.gz + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/metaeuk_output/.checkpoint + contains: + - "Tool: metaeuk" + - "Completed" + - "jobs" + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/metaeuk_output/combined_pred_proteins.fas + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/metaeuk_output/initial_results/genome.fasta.codon.fas + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/metaeuk_output/initial_results/genome.fasta.fas + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/metaeuk_output/initial_results/genome.fasta.gff + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/metaeuk_output/initial_results/genome.fasta.headersMap.tsv + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/metaeuk_output/refseq_db_rerun.faa + md5sum: d80b8fa4cb5ed0d47d63d6aa93635bc2 + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/metaeuk_output/rerun_results/genome.fasta.codon.fas + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/metaeuk_output/rerun_results/genome.fasta.fas + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/metaeuk_output/rerun_results/genome.fasta.gff + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/metaeuk_output/rerun_results/genome.fasta.headersMap.tsv + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/missing_busco_list.tsv + md5sum: 1e8e79c540fd2e69ba0d2659d9eb2988 + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/short_summary.json + contains: + - "one_line_summary" + - "mode" + - "dataset" + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/short_summary.txt + contains: + - "# BUSCO version is:" + - "Results:" + - "busco:" + - path: output/busco/test-eukaryota_odb10-busco/logs/busco.log + contains: + - "DEBUG:busco.run_BUSCO" + - "Results from dataset" + - "how to cite BUSCO" + - path: output/busco/versions.yml + +- name: busco test_busco_eukaryote_augustus + command: nextflow run ./tests/modules/nf-core/busco -entry test_busco_eukaryote_augustus -c ./tests/config/nextflow.config + tags: + - busco + files: + - path: output/busco/short_summary.specific.eukaryota_odb10.genome.fasta.json + contains: + - "one_line_summary" + - "mode" + - "dataset" + - path: output/busco/short_summary.specific.eukaryota_odb10.genome.fasta.txt + contains: + - "BUSCO version" + - "The lineage dataset is" + - "BUSCO was run in mode" + - "Complete BUSCOs" + - "Missing BUSCOs" + - "Dependencies and versions" + - path: output/busco/test-eukaryota_odb10-busco.batch_summary.txt + md5sum: ff6d8277e452a83ce9456bbee666feb6 + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/logs/bbtools_err.log + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/logs/bbtools_out.log + md5sum: e63debaa653f18f7405d936050abc093 + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/logs/hmmsearch_err.log + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/logs/hmmsearch_out.log + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/logs/metaeuk_run1_err.log + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/logs/metaeuk_run1_out.log + contains: + - "metaeuk" + - "easy-predict" + - "Compute score and coverage" + - "Time for processing:" + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/logs/metaeuk_run2_err.log + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/logs/metaeuk_run2_out.log + contains: + - "metaeuk" + - "easy-predict" + - "Compute score and coverage" + - "Time for processing:" + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/.bbtools_output/.checkpoint + contains: + - "Tool: bbtools" + - "Completed" + - "jobs" + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/busco_sequences/fragmented_busco_sequences.tar.gz + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/busco_sequences/multi_copy_busco_sequences.tar.gz + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/busco_sequences/single_copy_busco_sequences.tar.gz + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/full_table.tsv + md5sum: bd880e90b9e5620a58943a3e0f9ff16b + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/hmmer_output.tar.gz + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/metaeuk_output/.checkpoint + contains: + - "Tool: metaeuk" + - "Completed" + - "jobs" + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/metaeuk_output/combined_pred_proteins.fas + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/metaeuk_output/initial_results/genome.fasta.codon.fas + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/metaeuk_output/initial_results/genome.fasta.fas + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/metaeuk_output/initial_results/genome.fasta.gff + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/metaeuk_output/initial_results/genome.fasta.headersMap.tsv + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/metaeuk_output/refseq_db_rerun.faa + md5sum: d80b8fa4cb5ed0d47d63d6aa93635bc2 + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/metaeuk_output/rerun_results/genome.fasta.codon.fas + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/metaeuk_output/rerun_results/genome.fasta.fas + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/metaeuk_output/rerun_results/genome.fasta.gff + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/metaeuk_output/rerun_results/genome.fasta.headersMap.tsv + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/missing_busco_list.tsv + md5sum: 1e8e79c540fd2e69ba0d2659d9eb2988 + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/short_summary.json + contains: + - "one_line_summary" + - "mode" + - "dataset" + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/short_summary.txt + contains: + - "# BUSCO version is:" + - "Results:" + - "busco:" + - path: output/busco/test-eukaryota_odb10-busco/logs/busco.log + contains: + - "DEBUG:busco.run_BUSCO" + - "Results from dataset" + - "how to cite BUSCO" + - path: output/busco/versions.yml + +- name: busco test_busco_protein + command: nextflow run ./tests/modules/nf-core/busco -entry test_busco_protein -c ./tests/config/nextflow.config + tags: + - busco + files: + - path: output/busco/short_summary.specific.bacteria_odb10.proteome.fasta.json + contains: + - "one_line_summary" + - "mode" + - "dataset" + - path: output/busco/short_summary.specific.bacteria_odb10.proteome.fasta.txt + contains: + - "BUSCO version" + - "The lineage dataset is" + - "BUSCO was run in mode" + - "Complete BUSCOs" + - "Missing BUSCOs" + - "Dependencies and versions" + - path: output/busco/test-bacteria_odb10-busco.batch_summary.txt + md5sum: 7a65e6cbb6c56a2ea4e739ae0aa3297d + - path: output/busco/test-bacteria_odb10-busco/logs/busco.log + contains: + - "DEBUG:busco.run_BUSCO" + - "Results from dataset" + - "how to cite BUSCO" + - path: output/busco/test-bacteria_odb10-busco/proteome.fasta/logs/hmmsearch_err.log + - path: output/busco/test-bacteria_odb10-busco/proteome.fasta/logs/hmmsearch_out.log + contains: + - "# hmmsearch :: search profile(s) against a sequence database" + - "# target sequence database:" + - "Internal pipeline statistics summary:" + - "[ok]" + - path: output/busco/test-bacteria_odb10-busco/proteome.fasta/run_bacteria_odb10/busco_sequences/fragmented_busco_sequences.tar.gz + - path: output/busco/test-bacteria_odb10-busco/proteome.fasta/run_bacteria_odb10/busco_sequences/multi_copy_busco_sequences.tar.gz + - path: output/busco/test-bacteria_odb10-busco/proteome.fasta/run_bacteria_odb10/busco_sequences/single_copy_busco_sequences.tar.gz + - path: output/busco/test-bacteria_odb10-busco/proteome.fasta/run_bacteria_odb10/full_table.tsv + md5sum: 0e34f1011cd83ea1d5d5103ec62b8922 + - path: output/busco/test-bacteria_odb10-busco/proteome.fasta/run_bacteria_odb10/hmmer_output.tar.gz + - path: output/busco/test-bacteria_odb10-busco/proteome.fasta/run_bacteria_odb10/missing_busco_list.tsv + md5sum: 9939309df2da5419de88c32d1435c779 + - path: output/busco/test-bacteria_odb10-busco/proteome.fasta/run_bacteria_odb10/short_summary.json + contains: + - "one_line_summary" + - "mode" + - "dataset" + - path: output/busco/test-bacteria_odb10-busco/proteome.fasta/run_bacteria_odb10/short_summary.txt + contains: + - "# BUSCO version is:" + - "Results:" + - "busco:" + - path: output/busco/versions.yml + +- name: busco test_busco_transcriptome + command: nextflow run ./tests/modules/nf-core/busco -entry test_busco_transcriptome -c ./tests/config/nextflow.config + tags: + - busco + files: + - path: output/busco/short_summary.specific.bacteria_odb10.test1.contigs.fa.json + contains: + - "one_line_summary" + - "mode" + - "dataset" + - path: output/busco/short_summary.specific.bacteria_odb10.test1.contigs.fa.txt + contains: + - "BUSCO version" + - "The lineage dataset is" + - "BUSCO was run in mode" + - "Complete BUSCOs" + - "Missing BUSCOs" + - "Dependencies and versions" + - path: output/busco/test-bacteria_odb10-busco.batch_summary.txt + md5sum: 46118ecf60d1b87d22b96d80f4f03632 + - path: output/busco/test-bacteria_odb10-busco/logs/busco.log + contains: + - "DEBUG:busco.run_BUSCO" + - "Results from dataset" + - "how to cite BUSCO" + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/blast_db/.checkpoint + contains: + - "Tool: makeblastdb" + - "Completed" + - "jobs" + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/blast_db/test1.contigs.fa.ndb + md5sum: 3788c017fe5e6f0f58224e9cdd21822b + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/blast_db/test1.contigs.fa.nhr + md5sum: 8ecd2ce392bb5e25ddbe1d85f879582e + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/blast_db/test1.contigs.fa.nin + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/blast_db/test1.contigs.fa.njs + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/blast_db/test1.contigs.fa.not + md5sum: 0c340e376c7e85d19f82ec1a833e6a6e + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/blast_db/test1.contigs.fa.nsq + md5sum: 532d5c0a7ea00fe95ca3c97cb3be6198 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/blast_db/test1.contigs.fa.ntf + md5sum: de1250813f0c7affc6d12dac9d0fb6bb + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/blast_db/test1.contigs.fa.nto + md5sum: ff74bd41f9cc9b011c63a32c4f7693bf + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/logs/hmmsearch_err.log + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/logs/hmmsearch_out.log + contains: + - "# hmmsearch :: search profile(s) against a sequence database" + - "# target sequence database:" + - "Internal pipeline statistics summary:" + - "[ok]" + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/logs/makeblastdb_err.log + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/logs/makeblastdb_out.log + contains: + - "Building a new DB" + - "Adding sequences from FASTA" + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/logs/tblastn_err.log + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/logs/tblastn_out.log + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/blast_output/.checkpoint + contains: + - "Tool: tblastn" + - "Completed" + - "jobs" + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/blast_output/coordinates.tsv + md5sum: cc30eed321944af293452bdbcfc24292 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/blast_output/sequences/k141_101.temp + md5sum: 73e9c65fc83fedc58f57f09b08f08238 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/blast_output/sequences/k141_119.temp + md5sum: 7fa4cc7955ec0cc36330a221c579b975 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/blast_output/sequences/k141_129.temp + md5sum: 6f1601c875d019e3f6f1f98ed8e988d4 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/blast_output/sequences/k141_138.temp + md5sum: 3f8e034686cd240c2330650d791bcae2 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/blast_output/sequences/k141_143.temp + md5sum: df3dfa8e9ba30ed70cf75b5e7abf2179 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/blast_output/sequences/k141_172.temp + md5sum: 7d463e0e6cf7169bc9077d8dc776dda1 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/blast_output/sequences/k141_178.temp + md5sum: 2288edf7fa4f88f51b4cf4d94086f77e + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/blast_output/sequences/k141_188.temp + md5sum: 029906abbad6d87fc57830dd548cac24 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/blast_output/sequences/k141_195.temp + md5sum: 4937f3b348774a31b1160a00297c29cc + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/blast_output/sequences/k141_210.temp + md5sum: afcb20ba4c466479d6b91c8c62251e1f + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/blast_output/sequences/k141_232.temp + md5sum: 2e1e823ce017345bd998191a39fa9924 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/blast_output/sequences/k141_268.temp + md5sum: 08c2d82c34ecffbe1c638b410349412e + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/blast_output/sequences/k141_29.temp + md5sum: cd9b63cf93524284781535c888313764 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/blast_output/sequences/k141_44.temp + md5sum: d1929b742b24ebe379bf4801ca882dca + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/blast_output/sequences/k141_58.temp + md5sum: 69215765b010c05336538cb322c900b3 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/blast_output/sequences/k141_72.temp + md5sum: 6feaa1cc3b0899a147ea9d466878f3e3 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/blast_output/sequences/k141_80.temp + md5sum: 13625eae14e860a96ce17cd4e37e9d01 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/blast_output/sequences/k141_81.temp + md5sum: e14b2484649b0dbc8926815c207b806d + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/blast_output/sequences/k141_93.temp + md5sum: 6902c93691df00e690faea914c71839e + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/blast_output/sequences/k141_97.temp + md5sum: 0a0d9d38a83acbd5ad43c29cdf429988 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/blast_output/tblastn.tsv + contains: + - "TBLASTN" + - "BLAST processed" + - "queries" + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/busco_sequences/fragmented_busco_sequences.tar.gz + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/busco_sequences/multi_copy_busco_sequences.tar.gz + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/busco_sequences/single_copy_busco_sequences.tar.gz + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/full_table.tsv + md5sum: 24df25199e13c88bd892fc3e7b541ca0 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/hmmer_output.tar.gz + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/missing_busco_list.tsv + md5sum: e7232e2b8cca4fdfdd9e363b39ebbc81 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/short_summary.json + contains: + - "one_line_summary" + - "mode" + - "dataset" + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/short_summary.txt + contains: + - "# BUSCO version is:" + - "Results:" + - "busco:" + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/single_copy_proteins.faa + md5sum: e04b9465733577ae6e4bccb7aa01e720 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/translated_proteins/1024388at2.faa + md5sum: 7333c39a20258f20c7019ea0cd83157c + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/translated_proteins/1054741at2.faa + md5sum: ebb481e77a824685fbe04d8a2f3a0d7d + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/translated_proteins/1093223at2.faa + md5sum: 34621c7d499034e8f8e6b92fd4020a93 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/translated_proteins/1151822at2.faa + md5sum: aa89ca381c1c70c9c4e1380351ca7c2a + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/translated_proteins/143460at2.faa + md5sum: f2e91d78b8dd3722840378789f29e8c8 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/translated_proteins/1491686at2.faa + md5sum: 73c25aef5c9cba7f4151804941b146ea + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/translated_proteins/1504821at2.faa + md5sum: cda556018d1f84ebe517e89f6fc107d0 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/translated_proteins/1574817at2.faa + md5sum: a9096c9fb8b25c78a72871ab0463acdc + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/translated_proteins/1592033at2.faa + md5sum: e463d25ce186c0cebfd749474f3a4c64 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/translated_proteins/1623045at2.faa + md5sum: f2cfd241590c6d8377286d6135480937 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/translated_proteins/1661836at2.faa + md5sum: 586569546fb9861502468e3d9ba2775c + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/translated_proteins/1674344at2.faa + md5sum: 24c658bee14ad84b062d81ad96642eb8 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/translated_proteins/1698718at2.faa + md5sum: 0b8e26ddf5149bbd8805be7af125208d + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/translated_proteins/1990650at2.faa + md5sum: 159320712ee01fb2ccb31a25df44eead + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/translated_proteins/223233at2.faa + md5sum: 812629c0b06ac3d18661c2ca78de0c08 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/translated_proteins/402899at2.faa + md5sum: f7ff4e1591342d30b77392a2e84b57d9 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/translated_proteins/505485at2.faa + md5sum: 7b34a24fc49c540d46fcf96ff5129564 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/translated_proteins/665824at2.faa + md5sum: 4cff2df64f6bcaff8bc19c234c8bcccd + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/translated_proteins/776861at2.faa + md5sum: 613af7a3fea30ea2bece66f603b9284a + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/translated_proteins/874197at2.faa + md5sum: a7cd1b13c9ef91c7ef4e31614166f197 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/translated_proteins/932854at2.faa + md5sum: fe313ffd5efdb0fed887a04fba352552 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/translated_proteins/95696at2.faa + md5sum: 4e1f30a2fea4dfbf9bb7fae2700622a0 + - path: output/busco/versions.yml diff --git a/modules/nf-core/busco/busco/tests/tags.yml b/modules/nf-core/busco/busco/tests/tags.yml new file mode 100644 index 00000000..7c4d2835 --- /dev/null +++ b/modules/nf-core/busco/busco/tests/tags.yml @@ -0,0 +1,2 @@ +busco/busco: + - "modules/nf-core/busco/busco/**" diff --git a/modules/nf-core/busco/meta.yml b/modules/nf-core/busco/meta.yml deleted file mode 100644 index 90b30d4d..00000000 --- a/modules/nf-core/busco/meta.yml +++ /dev/null @@ -1,96 +0,0 @@ -name: busco -description: Benchmarking Universal Single Copy Orthologs -keywords: - - quality control - - genome - - transcriptome - - proteome -tools: - - busco: - description: BUSCO provides measures for quantitative assessment of genome assembly, gene set, and transcriptome completeness based on evolutionarily informed expectations of gene content from near-universal single-copy orthologs selected from OrthoDB. - homepage: https://busco.ezlab.org/ - documentation: https://busco.ezlab.org/busco_userguide.html - tool_dev_url: https://gitlab.com/ezlab/busco - doi: "10.1007/978-1-4939-9173-0_14" - licence: ["MIT"] -input: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - fasta: - type: file - description: Nucleic or amino acid sequence file in FASTA format. - pattern: "*.{fasta,fna,fa,fasta.gz,fna.gz,fa.gz}" - - mode: - type: string - description: The mode to run Busco in. One of genome, proteins, or transcriptome - pattern: "{genome,proteins,transcriptome}" - - lineage: - type: string - description: The BUSCO lineage to use, or "auto" to automatically select lineage - - busco_lineages_path: - type: directory - description: Path to local BUSCO lineages directory. - - config_file: - type: file - description: Path to BUSCO config file. -output: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - batch_summary: - type: file - description: Summary of all sequence files analyzed - pattern: "*-busco.batch_summary.txt" - - short_summaries_txt: - type: file - description: Short Busco summary in plain text format - pattern: "short_summary.*.txt" - - short_summaries_json: - type: file - description: Short Busco summary in JSON format - pattern: "short_summary.*.json" - - busco_dir: - type: directory - description: BUSCO lineage specific output - pattern: "*-busco" - - full_table: - type: file - description: Full BUSCO results table - pattern: "full_table.tsv" - - missing_busco_list: - type: file - description: List of missing BUSCOs - pattern: "missing_busco_list.tsv" - - single_copy_proteins: - type: file - description: Fasta file of single copy proteins (transcriptome mode) - pattern: "single_copy_proteins.faa" - - seq_dir: - type: directory - description: BUSCO sequence directory - pattern: "busco_sequences" - - translated_proteins: - type: directory - description: Six frame translations of each transcript made by the transcriptome mode - pattern: "translated_proteins" - - versions: - type: file - description: File containing software versions - pattern: "versions.yml" -authors: - - "@priyanka-surana" - - "@charles-plessy" - - "@mahesh-panchal" - - "@muffato" - - "@jvhagey" -maintainers: - - "@priyanka-surana" - - "@charles-plessy" - - "@mahesh-panchal" - - "@muffato" - - "@jvhagey" diff --git a/subworkflows/local/busco_diamond_blastp.nf b/subworkflows/local/busco_diamond_blastp.nf index 2e1a442d..69a65b24 100644 --- a/subworkflows/local/busco_diamond_blastp.nf +++ b/subworkflows/local/busco_diamond_blastp.nf @@ -2,7 +2,7 @@ // Run BUSCO for a genome and runs diamond_blastp // -include { BUSCO } from '../../modules/nf-core/busco/main' +include { BUSCO_BUSCO as BUSCO } from '../../modules/nf-core/busco/busco/main' include { BLOBTOOLKIT_EXTRACTBUSCOS } from '../../modules/local/blobtoolkit/extractbuscos' include { DIAMOND_BLASTP } from '../../modules/nf-core/diamond/blastp/main' include { RESTRUCTUREBUSCODIR } from '../../modules/local/restructurebuscodir' From 4e5a9420885417e36d8cef5f11349210cb628ce2 Mon Sep 17 00:00:00 2001 From: Tyler Chafin Date: Thu, 21 Nov 2024 18:25:20 +0000 Subject: [PATCH 04/10] cleanup ignored file --- .params_2024-11-19_19-46-41.json | 57 -------------------------------- 1 file changed, 57 deletions(-) delete mode 100644 .params_2024-11-19_19-46-41.json diff --git a/.params_2024-11-19_19-46-41.json b/.params_2024-11-19_19-46-41.json deleted file mode 100644 index af2a6937..00000000 --- a/.params_2024-11-19_19-46-41.json +++ /dev/null @@ -1,57 +0,0 @@ -{ - "input": "/Users/tc25/projects/blobtoolkit_tkc/assets/test/samplesheet_s3.csv", - "align": false, - "mask": false, - "fetchngs_samplesheet": false, - "busco_lineages": null, - "fasta": "https://tolit.cog.sanger.ac.uk/test-data/Meles_meles/assembly/release/mMelMel3.1_paternal_haplotype/GCA_922984935.2.subset.phiXspike.fasta.gz", - "accession": "GCA_922984935.2", - "taxon": "Meles meles", - "image_format": "png", - "taxdump": "https://ftp.ncbi.nlm.nih.gov/pub/taxonomy/new_taxdump/new_taxdump.tar.gz", - "busco": "https://tolit.cog.sanger.ac.uk/test-data/Meles_meles/resources/blobtoolkit.GCA_922984935.2.2023-08-03.tar.gz", - "lineage_tax_ids": "/Users/tc25/projects/blobtoolkit_tkc/assets/mapping_taxids-busco_dataset_name.2019-12-16.txt", - "blastp": "https://tolit.cog.sanger.ac.uk/test-data/Meles_meles/resources/mMelMel3.1.buscogenes.dmnd.tar.gz", - "blastx": "https://tolit.cog.sanger.ac.uk/test-data/Meles_meles/resources/mMelMel3.1.buscoregions.dmnd.tar.gz", - "blastn": "https://tolit.cog.sanger.ac.uk/test-data/Meles_meles/resources/nt_mMelMel3.1.tar.gz", - "skip_taxon_filtering": false, - "use_work_dir_as_temp": true, - "multiqc_config": null, - "multiqc_title": null, - "multiqc_logo": null, - "max_multiqc_email_size": "25.MB", - "multiqc_methods_description": null, - "outdir": "results", - "publish_dir_mode": "copy", - "email": null, - "email_on_fail": null, - "plaintext_email": false, - "monochrome_logs": false, - "hook_url": null, - "help": false, - "version": false, - "config_profile_name": "Test profile", - "config_profile_description": "Minimal aligned test dataset to check pipeline function", - "custom_config_version": "master", - "custom_config_base": "https://raw.githubusercontent.com/nf-core/configs/master", - "config_profile_contact": null, - "config_profile_url": null, - "max_memory": "6.GB", - "max_cpus": 2, - "max_time": "6.h", - "validationFailUnrecognisedParams": false, - "validation-fail-unrecognised-params": false, - "validationLenientMode": false, - "validation-lenient-mode": false, - "validationSchemaIgnoreParams": "genomes,igenomes_base", - "validation-schema-ignore-params": "genomes,igenomes_base", - "validationShowHiddenParams": false, - "validation-show-hidden-params": false, - "validate_params": true, - "validationSkipDuplicateCheck": false, - "validation-skip-duplicate-check": false, - "validationS3PathCheck": false, - "validation-S3Path-check": false, - "monochromeLogs": false, - "monochrome-logs": false -} \ No newline at end of file From 37061655d699d35c98cea14810d3c0363f41c792 Mon Sep 17 00:00:00 2001 From: Tyler Chafin Date: Fri, 22 Nov 2024 13:01:31 +0000 Subject: [PATCH 05/10] prettier linting --- modules.json | 74 ++++++++++++++-------------------------------------- 1 file changed, 19 insertions(+), 55 deletions(-) diff --git a/modules.json b/modules.json index ed215220..c8786231 100644 --- a/modules.json +++ b/modules.json @@ -8,136 +8,100 @@ "blast/blastn": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": [ - "modules" - ], + "installed_by": ["modules"], "patch": "modules/nf-core/blast/blastn/blast-blastn.diff" }, "busco/busco": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": [ - "modules" - ], + "installed_by": ["modules"], "patch": "modules/nf-core/busco/busco/busco-busco.diff" }, "cat/cat": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "custom/dumpsoftwareversions": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "diamond/blastp": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": [ - "modules" - ], + "installed_by": ["modules"], "patch": "modules/nf-core/diamond/blastp/diamond-blastp.diff" }, "diamond/blastx": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": [ - "modules" - ], + "installed_by": ["modules"], "patch": "modules/nf-core/diamond/blastx/diamond-blastx.diff" }, "fastawindows": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": [ - "modules" - ], + "installed_by": ["modules"], "patch": "modules/nf-core/fastawindows/fastawindows.diff" }, "gunzip": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "minimap2/align": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": [ - "modules" - ], + "installed_by": ["modules"], "patch": "modules/nf-core/minimap2/align/minimap2-align.diff" }, "multiqc": { "branch": "master", "git_sha": "cf17ca47590cc578dfb47db1c2a44ef86f89976d", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "pigz/compress": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "samtools/flagstat": { "branch": "master", "git_sha": "b13f07be4c508d6ff6312d354d09f2493243e208", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "samtools/index": { "branch": "master", "git_sha": "b13f07be4c508d6ff6312d354d09f2493243e208", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "samtools/view": { "branch": "master", "git_sha": "669eb24fd82a9d3cb18ad0e73673ecb26827f683", - "installed_by": [ - "modules" - ], + "installed_by": ["modules"], "patch": "modules/nf-core/samtools/view/samtools-view.diff" }, "seqtk/subseq": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": [ - "modules" - ], + "installed_by": ["modules"], "patch": "modules/nf-core/seqtk/subseq/seqtk-subseq.diff" }, "untar": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "windowmasker/mkcounts": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "windowmasker/ustat": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] } } }, @@ -146,4 +110,4 @@ } } } -} \ No newline at end of file +} From c0b8e31c1cec8574bde5da10fe2479132fccbe5d Mon Sep 17 00:00:00 2001 From: Matthieu Muffato Date: Thu, 24 Oct 2024 14:29:49 +0100 Subject: [PATCH 06/10] Removed references to "defaults" --- lib/Utils.groovy | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/lib/Utils.groovy b/lib/Utils.groovy index 8d030f4e..13cb02df 100755 --- a/lib/Utils.groovy +++ b/lib/Utils.groovy @@ -22,7 +22,7 @@ class Utils { // Check that all channels are present // This channel list is ordered by required channel priority. - def required_channels_in_order = ['conda-forge', 'bioconda', 'defaults'] + def required_channels_in_order = ['conda-forge', 'bioconda'] def channels_missing = ((required_channels_in_order as Set) - (channels as Set)) as Boolean // Check that they are in the right order From 1342ba0436c8ed91ad09990b54595b62f947dd39 Mon Sep 17 00:00:00 2001 From: Matthieu Muffato Date: Mon, 25 Nov 2024 09:23:04 +0000 Subject: [PATCH 07/10] Updated the modules --- modules.json | 4 ++-- modules/nf-core/samtools/flagstat/main.nf | 1 - modules/nf-core/samtools/view/main.nf | 2 +- modules/nf-core/samtools/view/samtools-view.diff | 2 +- 4 files changed, 4 insertions(+), 5 deletions(-) diff --git a/modules.json b/modules.json index c8786231..4e41c5ef 100644 --- a/modules.json +++ b/modules.json @@ -68,7 +68,7 @@ }, "samtools/flagstat": { "branch": "master", - "git_sha": "b13f07be4c508d6ff6312d354d09f2493243e208", + "git_sha": "2d20463181b1c38981a02e90d3084b5f9fa8d540", "installed_by": ["modules"] }, "samtools/index": { @@ -78,7 +78,7 @@ }, "samtools/view": { "branch": "master", - "git_sha": "669eb24fd82a9d3cb18ad0e73673ecb26827f683", + "git_sha": "2d20463181b1c38981a02e90d3084b5f9fa8d540", "installed_by": ["modules"], "patch": "modules/nf-core/samtools/view/samtools-view.diff" }, diff --git a/modules/nf-core/samtools/flagstat/main.nf b/modules/nf-core/samtools/flagstat/main.nf index 4a499727..c23f3a5c 100644 --- a/modules/nf-core/samtools/flagstat/main.nf +++ b/modules/nf-core/samtools/flagstat/main.nf @@ -18,7 +18,6 @@ process SAMTOOLS_FLAGSTAT { task.ext.when == null || task.ext.when script: - def args = task.ext.args ?: '' def prefix = task.ext.prefix ?: "${meta.id}" """ samtools \\ diff --git a/modules/nf-core/samtools/view/main.nf b/modules/nf-core/samtools/view/main.nf index 37e05cec..4f69a94b 100644 --- a/modules/nf-core/samtools/view/main.nf +++ b/modules/nf-core/samtools/view/main.nf @@ -63,7 +63,7 @@ process SAMTOOLS_VIEW { input.getExtension() if ("$input" == "${prefix}.${file_type}") error "Input and output names are the same, use \"task.ext.prefix\" to disambiguate!" - def index = args.contains("--write-index") ? "touch ${prefix}.${file_type}.csi" : "" + index = args.contains("--write-index") ? "touch ${prefix}.${file_type}.csi" : "" """ touch ${prefix}.${file_type} diff --git a/modules/nf-core/samtools/view/samtools-view.diff b/modules/nf-core/samtools/view/samtools-view.diff index d5c13034..fb47ba9a 100644 --- a/modules/nf-core/samtools/view/samtools-view.diff +++ b/modules/nf-core/samtools/view/samtools-view.diff @@ -6,7 +6,7 @@ Changes in module 'nf-core/samtools/view' conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/9e/9edc2564215d5cd137a8b25ca8a311600987186d406b092022444adf3c4447f7/data' : -- 'community​.wave​.seqera​.io/library/htslib_samtools:1​.21--6cb89bfd40cbaabf' }" +- 'community.wave.seqera.io/library/htslib_samtools:1.21--6cb89bfd40cbaabf' }" + 'https://depot.galaxyproject.org/singularity/samtools:1.21--h50ea8bc_0' : + 'biocontainers/samtools:1.21--h50ea8bc_0' }" From 16ed4ecb2073ada0acf3ecc70dec4582c7f25148 Mon Sep 17 00:00:00 2001 From: Matthieu Muffato Date: Mon, 25 Nov 2024 09:24:05 +0000 Subject: [PATCH 08/10] Updated a few more references to Anaconda --- CITATIONS.md | 4 ++-- README.md | 2 +- 2 files changed, 3 insertions(+), 3 deletions(-) diff --git a/CITATIONS.md b/CITATIONS.md index a3a1a070..1e18be72 100644 --- a/CITATIONS.md +++ b/CITATIONS.md @@ -50,9 +50,9 @@ ## Software packaging/containerisation tools -- [Anaconda](https://anaconda.com) +- [Conda](https://conda.org/) - > Anaconda Software Distribution. Computer software. Vers. 2-2.4.0. Anaconda, Nov. 2016. Web. + > conda contributors. conda: A system-level, binary package and environment manager running on all major operating systems and platforms. Computer software. https://github.com/conda/conda - [Bioconda](https://bioconda.github.io) diff --git a/README.md b/README.md index ed74da7c..11e394fa 100644 --- a/README.md +++ b/README.md @@ -4,7 +4,7 @@ [![GitHub Actions Linting Status](https://github.com/sanger-tol/blobtoolkit/workflows/nf-core%20linting/badge.svg)](https://github.com/sanger-tol/blobtoolkit/actions?query=workflow%3A%22nf-core+linting%22)[![Cite with Zenodo](http://img.shields.io/badge/DOI-10.5281/zenodo.7949058-1073c8?labelColor=000000)](https://doi.org/10.5281/zenodo.7949058) [![Nextflow](https://img.shields.io/badge/nextflow%20DSL2-%E2%89%A523.04.0-23aa62.svg)](https://www.nextflow.io/) -[![run with conda](http://img.shields.io/badge/run%20with-conda-3EB049?labelColor=000000&logo=anaconda)](https://docs.conda.io/en/latest/) +[![run with conda](http://img.shields.io/badge/run%20with-conda-3EB049?labelColor=000000&logo=conda)](https://docs.conda.io/en/latest/) [![run with docker](https://img.shields.io/badge/run%20with-docker-0db7ed?labelColor=000000&logo=docker)](https://www.docker.com/) [![run with singularity](https://img.shields.io/badge/run%20with-singularity-1d355c.svg?labelColor=000000)](https://sylabs.io/docs/) [![Launch on Nextflow Tower](https://img.shields.io/badge/Launch%20%F0%9F%9A%80-Nextflow%20Tower-%234256e7)](https://tower.nf/launch?pipeline=https://github.com/sanger-tol/blobtoolkit) From 3976215151e0b941a88894f84cf53d10f9e44312 Mon Sep 17 00:00:00 2001 From: Matthieu Muffato Date: Mon, 25 Nov 2024 13:37:03 +0000 Subject: [PATCH 09/10] Updated the changelog too --- CHANGELOG.md | 12 ++++++++---- docs/usage.md | 2 +- modules/local/blobtoolkit/chunk.nf | 2 +- modules/local/blobtoolkit/countbuscos.nf | 2 +- modules/local/blobtoolkit/createblobdir.nf | 2 +- modules/local/blobtoolkit/extractbuscos.nf | 2 +- modules/local/blobtoolkit/summary.nf | 2 +- modules/local/blobtoolkit/unchunk.nf | 2 +- modules/local/blobtoolkit/updateblobdir.nf | 2 +- modules/local/blobtoolkit/updatemeta.nf | 2 +- modules/local/blobtoolkit/windowstats.nf | 2 +- modules/local/generate_config.nf | 2 +- 12 files changed, 19 insertions(+), 15 deletions(-) diff --git a/CHANGELOG.md b/CHANGELOG.md index c5d7c7b9..0557ad5b 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -19,9 +19,13 @@ The pipeline is now considered to be a complete and suitable replacement for the Note, since the pipeline is using Nextflow DSL2, each process will be run with its own [Biocontainer](https://biocontainers.pro/#/registry). This means that on occasion it is entirely possible for the pipeline to be using different versions of the same tool. However, the overall software dependency changes compared to the last release have been listed below for reference. Only `Docker` or `Singularity` containers are supported, `conda` is not supported. -| Dependency | Old version | New version | -| ----------- | ----------- | ----------- | -| blobtoolkit | 4.3.9 | 4.3.13 | +| Dependency | Old version | New version | +| ----------- | ----------------- | --------------- | +| blast | 2.14.1 and 2.15.0 | only 2.15.0 | +| blobtoolkit | 4.3.9 | 4.4.0 | +| busco | 5.5.0 | 5.7.1 | +| multiqc | 1.20 and 1.21 | 1.20 and 1.25.1 | +| samtools | 1.18 and 1.19.2 | 1.20 and 1.21 | ## [[0.6.0](https://github.com/sanger-tol/blobtoolkit/releases/tag/0.6.0)] – Bellsprout – [2024-09-13] @@ -112,7 +116,7 @@ Note, since the pipeline is using Nextflow DSL2, each process will be run with i | blobtoolkit | 4.3.3 | 4.3.9 | | blast | 2.14.0 | 2.15.0 and 2.14.1 | | multiqc | 1.17 and 1.18 | 1.20 and 1.21 | -| samtools | 1.18 | 1.19.2 | +| samtools | 1.18 | 1.18 and 1.19.2 | | seqtk | 1.3 | 1.4 | > **NB:** Dependency has been **updated** if both old and new version information is present.
**NB:** Dependency has been **added** if just the new version information is present.
**NB:** Dependency has been **removed** if version information isn't present. diff --git a/docs/usage.md b/docs/usage.md index 6f8909bf..8fe227b7 100644 --- a/docs/usage.md +++ b/docs/usage.md @@ -272,7 +272,7 @@ List of tools for any given dataset can be fetched from the API, for example htt | Dependency | Snakemake | Nextflow | | ----------------- | --------- | -------- | -| blobtoolkit | 4.3.2 | 4.3.13 | +| blobtoolkit | 4.3.2 | 4.4.0 | | blast | 2.12.0 | 2.14.1 | | blobtk | 0.5.0 | 0.5.1 | | busco | 5.3.2 | 5.5.0 | diff --git a/modules/local/blobtoolkit/chunk.nf b/modules/local/blobtoolkit/chunk.nf index 0b8a7989..80deca41 100644 --- a/modules/local/blobtoolkit/chunk.nf +++ b/modules/local/blobtoolkit/chunk.nf @@ -5,7 +5,7 @@ process BLOBTOOLKIT_CHUNK { if (workflow.profile.tokenize(',').intersect(['conda', 'mamba']).size() >= 1) { exit 1, "BLOBTOOLKIT_CHUNK module does not support Conda. Please use Docker / Singularity / Podman instead." } - container "docker.io/genomehubs/blobtoolkit:4.3.13" + container "docker.io/genomehubs/blobtoolkit:4.4.0" input: tuple val(meta) , path(fasta) diff --git a/modules/local/blobtoolkit/countbuscos.nf b/modules/local/blobtoolkit/countbuscos.nf index 0e525ede..5cc9e37f 100644 --- a/modules/local/blobtoolkit/countbuscos.nf +++ b/modules/local/blobtoolkit/countbuscos.nf @@ -5,7 +5,7 @@ process BLOBTOOLKIT_COUNTBUSCOS { if (workflow.profile.tokenize(',').intersect(['conda', 'mamba']).size() >= 1) { exit 1, "BLOBTOOLKIT_COUNTBUSCOS module does not support Conda. Please use Docker / Singularity / Podman instead." } - container "docker.io/genomehubs/blobtoolkit:4.3.13" + container "docker.io/genomehubs/blobtoolkit:4.4.0" input: tuple val(meta), path(table, stageAs: 'dir??/*') diff --git a/modules/local/blobtoolkit/createblobdir.nf b/modules/local/blobtoolkit/createblobdir.nf index b68e32a1..487dfee3 100644 --- a/modules/local/blobtoolkit/createblobdir.nf +++ b/modules/local/blobtoolkit/createblobdir.nf @@ -5,7 +5,7 @@ process BLOBTOOLKIT_CREATEBLOBDIR { if (workflow.profile.tokenize(',').intersect(['conda', 'mamba']).size() >= 1) { exit 1, "BLOBTOOLKIT_BLOBDIR module does not support Conda. Please use Docker / Singularity / Podman instead." } - container "docker.io/genomehubs/blobtoolkit:4.3.13" + container "docker.io/genomehubs/blobtoolkit:4.4.0" input: tuple val(meta), path(window, stageAs: 'windowstats/*') diff --git a/modules/local/blobtoolkit/extractbuscos.nf b/modules/local/blobtoolkit/extractbuscos.nf index bd598539..c8346211 100644 --- a/modules/local/blobtoolkit/extractbuscos.nf +++ b/modules/local/blobtoolkit/extractbuscos.nf @@ -5,7 +5,7 @@ process BLOBTOOLKIT_EXTRACTBUSCOS { if (workflow.profile.tokenize(',').intersect(['conda', 'mamba']).size() >= 1) { exit 1, "BLOBTOOLKIT_EXTRACTBUSCOS module does not support Conda. Please use Docker / Singularity / Podman instead." } - container "docker.io/genomehubs/blobtoolkit:4.3.13" + container "docker.io/genomehubs/blobtoolkit:4.4.0" input: tuple val(meta), path(fasta) diff --git a/modules/local/blobtoolkit/summary.nf b/modules/local/blobtoolkit/summary.nf index 539fe9c8..e1736d67 100644 --- a/modules/local/blobtoolkit/summary.nf +++ b/modules/local/blobtoolkit/summary.nf @@ -5,7 +5,7 @@ process BLOBTOOLKIT_SUMMARY { if (workflow.profile.tokenize(',').intersect(['conda', 'mamba']).size() >= 1) { exit 1, "BLOBTOOLKIT_SUMMARY module does not support Conda. Please use Docker / Singularity / Podman instead." } - container "docker.io/genomehubs/blobtoolkit:4.3.13" + container "docker.io/genomehubs/blobtoolkit:4.4.0" input: tuple val(meta), path(blobdir) diff --git a/modules/local/blobtoolkit/unchunk.nf b/modules/local/blobtoolkit/unchunk.nf index 87fa1bb5..99060a6b 100644 --- a/modules/local/blobtoolkit/unchunk.nf +++ b/modules/local/blobtoolkit/unchunk.nf @@ -5,7 +5,7 @@ process BLOBTOOLKIT_UNCHUNK { if (workflow.profile.tokenize(',').intersect(['conda', 'mamba']).size() >= 1) { exit 1, "BLOBTOOLKIT_UNCHUNK module does not support Conda. Please use Docker / Singularity / Podman instead." } - container "docker.io/genomehubs/blobtoolkit:4.3.13" + container "docker.io/genomehubs/blobtoolkit:4.4.0" input: tuple val(meta), path(blast_table) diff --git a/modules/local/blobtoolkit/updateblobdir.nf b/modules/local/blobtoolkit/updateblobdir.nf index b3940642..f6bafae7 100644 --- a/modules/local/blobtoolkit/updateblobdir.nf +++ b/modules/local/blobtoolkit/updateblobdir.nf @@ -5,7 +5,7 @@ process BLOBTOOLKIT_UPDATEBLOBDIR { if (workflow.profile.tokenize(',').intersect(['conda', 'mamba']).size() >= 1) { exit 1, "BLOBTOOLKIT_BLOBDIR module does not support Conda. Please use Docker / Singularity / Podman instead." } - container "docker.io/genomehubs/blobtoolkit:4.3.13" + container "docker.io/genomehubs/blobtoolkit:4.4.0" input: tuple val(meta), path(input, stageAs: "input_blobdir") diff --git a/modules/local/blobtoolkit/updatemeta.nf b/modules/local/blobtoolkit/updatemeta.nf index 356e6699..de664149 100644 --- a/modules/local/blobtoolkit/updatemeta.nf +++ b/modules/local/blobtoolkit/updatemeta.nf @@ -5,7 +5,7 @@ process BLOBTOOLKIT_UPDATEMETA { if (workflow.profile.tokenize(',').intersect(['conda', 'mamba']).size() >= 1) { exit 1, "BLOBTOOLKIT_UPDATEMETA module does not support Conda. Please use Docker / Singularity / Podman instead." } - container "docker.io/genomehubs/blobtoolkit:4.3.13" + container "docker.io/genomehubs/blobtoolkit:4.4.0" input: tuple val(meta), path(input) diff --git a/modules/local/blobtoolkit/windowstats.nf b/modules/local/blobtoolkit/windowstats.nf index 7ca59db4..e6445f6b 100644 --- a/modules/local/blobtoolkit/windowstats.nf +++ b/modules/local/blobtoolkit/windowstats.nf @@ -4,7 +4,7 @@ process BLOBTOOLKIT_WINDOWSTATS { if (workflow.profile.tokenize(',').intersect(['conda', 'mamba']).size() >= 1) { exit 1, "BLOBTOOLKIT_WINDOWSTATS module does not support Conda. Please use Docker / Singularity / Podman instead." } - container "docker.io/genomehubs/blobtoolkit:4.3.13" + container "docker.io/genomehubs/blobtoolkit:4.4.0" input: tuple val(meta), path(tsv) diff --git a/modules/local/generate_config.nf b/modules/local/generate_config.nf index 12097381..d4200641 100644 --- a/modules/local/generate_config.nf +++ b/modules/local/generate_config.nf @@ -3,7 +3,7 @@ process GENERATE_CONFIG { label 'process_single' conda "conda-forge::requests=2.28.1 conda-forge::pyyaml=6.0" - container "docker.io/genomehubs/blobtoolkit:4.3.13" + container "docker.io/genomehubs/blobtoolkit:4.4.0" input: tuple val(meta), val(fasta) From 15974b49f63d1bf962cfaae044ec7a9769cea258 Mon Sep 17 00:00:00 2001 From: Matthieu Muffato Date: Mon, 25 Nov 2024 13:47:11 +0000 Subject: [PATCH 10/10] [prettier] --- docs/usage.md | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/docs/usage.md b/docs/usage.md index 8fe227b7..0fb6c0cb 100644 --- a/docs/usage.md +++ b/docs/usage.md @@ -272,7 +272,7 @@ List of tools for any given dataset can be fetched from the API, for example htt | Dependency | Snakemake | Nextflow | | ----------------- | --------- | -------- | -| blobtoolkit | 4.3.2 | 4.4.0 | +| blobtoolkit | 4.3.2 | 4.4.0 | | blast | 2.12.0 | 2.14.1 | | blobtk | 0.5.0 | 0.5.1 | | busco | 5.3.2 | 5.5.0 |