diff --git a/tests/bench/001-btree.buzz b/tests/bench/001-btree.buzz
index 8cbecd0b..2cd69717 100644
--- a/tests/bench/001-btree.buzz
+++ b/tests/bench/001-btree.buzz
@@ -2,11 +2,11 @@ import "std";
 import "math";
 
 object Node {
-    Node? left = null,
-    Node? right = null,
+    left: Node? = null,
+    right: Node? = null,
 }
 
-fun bottomUpTree(int depth) > Node {
+fun bottomUpTree(depth: int) > Node {
     if (depth > 0) {
         return Node{
             left = bottomUpTree(depth - 1),
@@ -17,7 +17,7 @@ fun bottomUpTree(int depth) > Node {
     return Node{};
 }
 
-fun itemCheck(Node tree) > int {
+fun itemCheck(tree: Node) > int {
     if (tree.left -> left) {
         return 1 + itemCheck(left) + itemCheck(tree.right!);
     } else {
@@ -27,22 +27,22 @@ fun itemCheck(Node tree) > int {
     return 0;
 }
 
-fun btree(int N) > void {
-    int mindepth = 4;
-    int maxdepth = mindepth + 2;
+fun btree(N: int) > void {
+    final mindepth = 4;
+    var maxdepth = mindepth + 2;
     if (maxdepth < N) {
         maxdepth = N;
     }
 
-    int stretchdepth = maxdepth + 1;
-    Node stretchtree = bottomUpTree(stretchdepth);
+    final stretchdepth = maxdepth + 1;
+    final stretchtree = bottomUpTree(stretchdepth);
     std\print("stretch tree of depth {stretchdepth},\t check: {itemCheck(stretchtree)}");
 
-    Node longlivedtree = bottomUpTree(maxdepth);
-    for (int depth = mindepth; depth < maxdepth; depth = depth + 2) {
-        int iterations = std\toInt(math\pow(x: 2.0, y: std\toDouble(maxdepth - depth + mindepth)) catch 0.0);
-        int check = 0;
-        for (int i = 0; i < iterations; i = i + 1) {
+    final longlivedtree = bottomUpTree(maxdepth);
+    for (depth: int = mindepth; depth < maxdepth; depth = depth + 2) {
+        final iterations = std\toInt(math\pow(x: 2.0, y: std\toDouble(maxdepth - depth + mindepth)) catch 0.0);
+        var check = 0;
+        foreach (_ in 0..iterations) {
             check = check + itemCheck(bottomUpTree(depth));
         }
 
@@ -52,8 +52,8 @@ fun btree(int N) > void {
     std\print("long lived tree of depth {maxdepth}\t check: {itemCheck(longlivedtree)}");
 }
 
-fun main([str] args) > void !> any {
-    int N = if (args.len() > 0) std\parseInt(args[0]) ?? 3 else 3;
-
-    btree(N);
+fun main(args: [str]) > void !> any {
+    btree(
+        std\parseInt(args[?0] ?? "3") ?? 3
+    );
 }
diff --git a/tests/bench/002-merkle.buzz b/tests/bench/002-merkle.buzz
index bf8d7f02..b833fac0 100644
--- a/tests/bench/002-merkle.buzz
+++ b/tests/bench/002-merkle.buzz
@@ -3,13 +3,13 @@ import "math";
 import "errors";
 
 object Node {
-    Node? left = null,
-    Node? right = null,
-    int? value = null,
-    int? hash = null,
+    left: Node? = null,
+    right: Node? = null,
+    value: int? = null,
+    hash: int? = null,
 }
 
-fun makeTree(int depth) > Node {
+fun makeTree(depth: int) > Node {
     if (depth > 0) {
         return Node{
             left = makeTree(depth - 1),
@@ -22,7 +22,7 @@ fun makeTree(int depth) > Node {
     };
 }
 
-fun check(Node tree) > bool {
+fun check(tree: Node) > bool {
     if (tree.hash != null) {
         if (tree.value != null) {
             return true;
@@ -34,7 +34,7 @@ fun check(Node tree) > bool {
     return false;
 }
 
-fun calHash(Node tree) > void {
+fun calHash(tree: Node) > void {
     if (tree.hash == null) {
         if (tree.value -> value) {
             tree.hash = value;
@@ -47,30 +47,32 @@ fun calHash(Node tree) > void {
     }
 }
 
-fun main([str] args) > void !> any {
-    int N = 6;
-    if (args.len() > 0) {
-        N = std\parseInt(args[0]) ?? 6;
-    }
+fun main(args: [str]) > void !> any {
+    final N = std\parseInt(args[?0] ?? "6") ?? 6;
 
-    int mindepth = 4;
-    int maxdepth = mindepth + 2;
+    final mindepth = 4;
+    var maxdepth = mindepth + 2;
     if (maxdepth < N) {
         maxdepth = N;
     }
 
-    int stretchdepth = maxdepth + 1;
-    Node stretchtree = makeTree(stretchdepth);
+    final stretchdepth = maxdepth + 1;
+    final stretchtree = makeTree(stretchdepth);
     calHash(stretchtree);
 
     std\print("stretch tree of depth {stretchdepth}\t root hash: {stretchtree.hash ?? 0} check: {check(stretchtree)}");
 
-    Node longlivedtree = makeTree(maxdepth);
-    for (int depth = mindepth; depth < maxdepth; depth = depth + 2) {
-        int iterations = std\toInt(math\pow(x: 2.0, y: std\toDouble(maxdepth - depth + mindepth)));
-        int sum = 0;
-        for (int i = 0; i < iterations; i = i + 1) {
-            Node t = makeTree(depth);
+    final longlivedtree = makeTree(maxdepth);
+    for (depth: int = mindepth; depth < maxdepth; depth = depth + 2) {
+        final iterations = std\toInt(
+            math\pow(
+                x: 2.0,
+                y: std\toDouble(maxdepth - depth + mindepth)
+            )
+        );
+        var sum = 0;
+        foreach (_ in 0..iterations) {
+            final t = makeTree(depth);
             calHash(t);
             sum = sum + t.hash ?? 0;
         }
@@ -80,4 +82,4 @@ fun main([str] args) > void !> any {
 
     calHash(longlivedtree);
     std\print("long lived tree of depth {maxdepth}\t root hash: {longlivedtree.hash ?? 0} check: {check(longlivedtree)}");
-}
\ No newline at end of file
+}
diff --git a/tests/bench/003-nbody.buzz b/tests/bench/003-nbody.buzz
index 6492e37e..37d344a7 100644
--- a/tests/bench/003-nbody.buzz
+++ b/tests/bench/003-nbody.buzz
@@ -1,40 +1,40 @@
 import "std";
 import "math";
 
-final double pi = 3.141592653589793;
-final double solarMass = 4.0 * pi * pi;
-final double daysPerYear = 365.24;
+final pi = 3.141592653589793;
+final solarMass = 4.0 * pi * pi;
+final daysPerYear = 365.24;
 
 object Body {
-    double x,
-    double y,
-    double z,
-    double vx,
-    double vy,
-    double vz,
-    double mass,
+    x: double,
+    y: double,
+    z: double,
+    vx: double,
+    vy: double,
+    vz: double,
+    mass: double,
 }
 
-fun advance([Body] bodies, int nbody, double dt) > void {
-    for (int i = 0; i < nbody; i = i + 1) {
-        Body bi = bodies[i];
-        double bix = bi.x;
-        double biy = bi.y;
-        double biz = bi.z;
-        double bimass = bi.mass;
-        double bivx = bi.vx;
-        double bivy = bi.vy;
-        double bivz = bi.vz;
-
-        for (int j = i + 1; j < nbody; j = j + 1) {
-            Body bj = bodies[j];
-            double dx = bix - bj.x;
-            double dy = biy - bj.y;
-            double dz = biz - bj.z;
-            double dist2 = dx * dx + dy * dy + dz * dz;
-            double mag = math\sqrt(dist2);
+fun advance(bodies: [Body], nbody: int, dt: double) > void {
+    foreach (i in 0..nbody) {
+        final bi = bodies[i];
+        final bix = bi.x;
+        final biy = bi.y;
+        final biz = bi.z;
+        final bimass = bi.mass;
+        var bivx = bi.vx;
+        var bivy = bi.vy;
+        var bivz = bi.vz;
+
+        foreach (j in (i + 1)..nbody) {
+            final bj = bodies[j];
+            final dx = bix - bj.x;
+            final dy = biy - bj.y;
+            final dz = biz - bj.z;
+            final dist2 = dx * dx + dy * dy + dz * dz;
+            var mag = math\sqrt(dist2);
             mag = dt / (mag * dist2);
-            double bm = bj.mass * mag;
+            var bm = bj.mass * mag;
 
             bivx = bivx - (dx * bm);
             bivy = bivy - (dy * bm);
@@ -54,21 +54,21 @@ fun advance([Body] bodies, int nbody, double dt) > void {
     }
 }
 
-fun energy([Body] bodies, int nbody) > double {
-    double e = 0.0;
-    for (int i = 0; i < nbody; i = i + 1) {
-        Body bi = bodies[i];
-        double vx = bi.vx;
-        double vy = bi.vy;
-        double vz = bi.vz;
-        double bim = bi.mass;
+fun energy(bodies: [Body], nbody: int) > double {
+    var e = 0.0;
+    foreach (i in 0..nbody) {
+        final bi = bodies[i];
+        final vx = bi.vx;
+        final vy = bi.vy;
+        final vz = bi.vz;
+        final bim = bi.mass;
         e = e + (0.5 * bim * (vx * vx + vy * vy + vz * vz));
-        for (int j = i + 1; j < nbody; j = j + 1) {
-            Body bj = bodies[j];
-            double dx = bi.x - bj.x;
-            double dy = bi.y - bj.y;
-            double dz = bi.z - bj.z;
-            double distance = math\sqrt(dx * dx + dy * dy + dz * dz);
+        foreach (j in (i + 1)..nbody) {
+            final bj = bodies[j];
+            final dx = bi.x - bj.x;
+            final dy = bi.y - bj.y;
+            final dz = bi.z - bj.z;
+            final distance = math\sqrt(dx * dx + dy * dy + dz * dz);
             e = e - ((bim * bj.mass) / distance);
         }
     }
@@ -76,14 +76,14 @@ fun energy([Body] bodies, int nbody) > double {
     return e;
 }
 
-fun offsetMomentum([Body] b, int nbody) > void {
-    double px = 0.0;
-    double py = 0.0;
-    double pz = 0.0;
+fun offsetMomentum(b: [Body], nbody: int) > void {
+    var px = 0.0;
+    var py = 0.0;
+    var pz = 0.0;
 
-    for (int i = 0; i < nbody; i = i + 1) {
-        Body bi = b[i];
-        double bim = bi.mass;
+    foreach (i in 0..nbody) {
+        final bi = b[i];
+        final bim = bi.mass;
 
         px = px + (bi.vx * bim);
         py = py + (bi.vy * bim);
@@ -95,8 +95,8 @@ fun offsetMomentum([Body] b, int nbody) > void {
     b[0].vz = -pz / solarMass;
 }
 
-fun main([str] args) > void {
-    Body sun = Body{
+fun main(args: [str]) > void {
+    final sun = Body{
         x = 0.0,
         y = 0.0,
         z = 0.0,
@@ -106,7 +106,7 @@ fun main([str] args) > void {
         mass = solarMass,
     };
 
-    Body jupiter = Body{
+    final jupiter = Body{
         x = 4.84143144246472090,
         y = -1.16032004402742839,
         z = -0.103622044471123109,
@@ -116,7 +116,7 @@ fun main([str] args) > void {
         mass = 0.000954791938424326609 * solarMass,
     };
 
-    Body saturn = Body{
+    final saturn = Body{
         x = 8.34336671824457987,
         y = 4.12479856412430479,
         z = -0.403523417114321381,
@@ -126,7 +126,7 @@ fun main([str] args) > void {
         mass = 0.00028588598066613 * solarMass,
     };
 
-    Body uranus = Body{
+    final uranus = Body{
         x = 12.894369562139,
         y = -15.111151401699,
         z = -0.22330757889266,
@@ -136,7 +136,7 @@ fun main([str] args) > void {
         mass = 0.0000436624404335156298 * solarMass,
     };
 
-    Body neptune = Body{
+    final neptune = Body{
         x = 15.379697114851,
         y = -25.9193146099879641,
         z = 0.179258772950371181,
@@ -146,20 +146,17 @@ fun main([str] args) > void {
         mass = 0.0000515138902046611451 * solarMass,
     };
 
-    [Body] bodies = [ sun, jupiter, saturn, uranus, neptune ];
+    final bodies = [ sun, jupiter, saturn, uranus, neptune ];
 
-    int N = 1000;
-    if (args.len() > 0) {
-        N = std\parseInt(args[0]) ?? 1000;
-    }
-    int nbody = bodies.len();
+    final N = std\parseInt(args[?0] ?? "1000") ?? 1000;
+    final nbody = bodies.len();
 
     offsetMomentum(bodies, nbody: nbody);
     std\print("{energy(bodies, nbody: nbody)}");
 
-    for (int i = 0; i < N; i = i + 1) {
+    foreach (_ in 0..N) {
         advance(bodies, nbody: nbody, dt: 0.01);
     }
 
     std\print("{energy(bodies, nbody: nbody)}");
-}
\ No newline at end of file
+}
diff --git a/tests/bench/004-spectral.buzz b/tests/bench/004-spectral.buzz
index da1a8448..7c80dd59 100644
--- a/tests/bench/004-spectral.buzz
+++ b/tests/bench/004-spectral.buzz
@@ -1,64 +1,61 @@
 import "std";
 import "math";
 
-fun A(double i, double j) > double {
-    double ij = i + j - 1.0;
+fun A(i: double, j: double) > double {
+    final ij = i + j - 1.0;
     return 1.0 / (ij * (ij - 1.0) * 0.5 + i);
 }
 
-fun Av([double] x, [double] y, int N) > void {
-    for (double i = 0.0; i < N; i = i + 1.0) {
-        double a = 0.0;
-        for (double j = 0.0; j < N; j = j + 1.0) {
+fun Av(x: [double], y: [double], N: int) > void {
+    for (i: double = 0.0; i < N; i = i + 1.0) {
+        var a = 0.0;
+        for (j: double = 0.0; j < N; j = j + 1.0) {
             a = a + x[std\toInt(j)] * A(i: i, j: j);
         }
         y[std\toInt(i)] = a;
     }
 }
 
-fun Atv([double] x, [double] y, int N) > void {
-    for (double i = 0.0; i < N; i = i + 1.0) {
-        double a = 0.0;
-        for (double j = 0.0; j < N; j = j + 1.0) {
+fun Atv(x: [double], y: [double], N: int) > void {
+    for (i: double = 0.0; i < N; i = i + 1.0) {
+        var a = 0.0;
+        for (j: double = 0.0; j < N; j = j + 1.0) {
             a = a + x[std\toInt(j)] * A(i: j, j: i);
         }
         y[std\toInt(i)] = a;
     }
 }
 
-fun AtAv([double] x, [double] y, [double] t, int N) > void {
+fun AtAv(x: [double], y: [double], t: [double], N: int) > void {
     Av(x: x, y: t, N: N);
     Atv(x: t, y: y, N: N);
 }
 
-fun main([str] args) > void {
-    int N = 100;
-    if (args.len() > 0) {
-        N = std\parseInt(args[0]) ?? 100;
-    }
+fun main(args: [str]) > void {
+    final N = std\parseInt(args[?0] ?? "100") ?? 100;
 
-    [double] u = [<double>];
-    [double] v = [<double>];
-    [double] t = [<double>];
-    for (int i = 0; i < N; i = i + 1) {
+    final u = [<double>];
+    final v = [<double>];
+    final t = [<double>];
+    foreach (_ in 0..N) {
         u.append(1.0);
         v.append(0.0);
         t.append(0.0);
     }
 
-    for (int i = 0; i < 10; i = i + 1) {
+    foreach (_ in 0..10) {
         AtAv(x: u, y: v, t: t, N: N);
         AtAv(x: v, y: u, t: t, N: N);
     }
 
-    double vBv = 0.0;
-    double vv = 0.0;
-    for (int i = 0; i < N; i = i + 1) {
-        double ui = u[i];
-        double vi = v[i];
+    var vBv = 0.0;
+    var vv = 0.0;
+    foreach (i in 0..N) {
+        final ui = u[i];
+        final vi = v[i];
         vBv = vBv + ui * vi;
         vv = vv + vi * vi;
     }
 
     std\print("{math\sqrt(vBv / vv)}");
-}
\ No newline at end of file
+}
diff --git a/tests/bench/005-k-nucleoide.buzz b/tests/bench/005-k-nucleoide.buzz
index 55e7c27d..f0714355 100644
--- a/tests/bench/005-k-nucleoide.buzz
+++ b/tests/bench/005-k-nucleoide.buzz
@@ -3,15 +3,15 @@ import "io";
 import "errors";
 
 fun readSequence() > str !> errors\ReadWriteError, errors\FileSystemError, errors\UnexpectedError {
-    bool skippedIgnoredSequences = false;
-    [str] lines = [<str>];
-    for (str? line = ""; line != null; line = io\stdin.readLine()) { // catch null doesn't work
+    var skippedIgnoredSequences = false;
+    final lines = [<str>];
+    for (line: str? = ""; line != null; line = io\stdin.readLine()) { // catch null doesn't work
         if (!skippedIgnoredSequences) {
             if (line?.startsWith(">THREE") ?? true) {
                 skippedIgnoredSequences = true;
             }
         } else {
-            str c = line?[0] ?? "_";
+            final c = line?[0] ?? "_";
             if (c == ">") {
                 break;
             } else if (c != ";") {
@@ -23,38 +23,38 @@ fun readSequence() > str !> errors\ReadWriteError, errors\FileSystemError, error
     return lines.join("").upper();
 }
 
-fun kfrequency(str sequence, {str: int} frequency, int k, int frame) > void {
-    for (int i = frame; i < sequence.len(); i = i + k) {
-        str c = sequence.sub(i, len: k);
+fun kfrequency(sequence: str, frequency: {str: int}, k: int, frame: int) > void {
+    for (i: int = frame; i < sequence.len(); i = i + k) {
+        final c = sequence.sub(i, len: k);
         frequency[c] = (frequency[c] ?? 0) + 1;
     }
 }
 
-fun count(str sequence, str fragment) > void {
-    final int k = fragment.len();
-    {str: int} frequency = {<str: int>};
-    for (int frame = 0; frame < k; frame = frame + 1) {
+fun count(sequence: str, fragment: str) > void {
+    final k = fragment.len();
+    final frequency = {<str: int>};
+    for (frame: int = 0; frame < k; frame = frame + 1) {
         kfrequency(sequence, frequency: frequency, k: k, frame: frame);
     }
     std\print("{frequency[fragment] ?? 0}\t{fragment}");
 }
 
-fun frequency(str sequence, int k) > void {
-    {str: int} frequency = {<str: int>};
-    for (int frame = 0; frame < k; frame = frame + 1) {
+fun frequency(sequence: str, k: int) > void {
+    final frequency = {<str: int>};
+    for (frame: int = 0; frame < k; frame = frame + 1) {
         kfrequency(sequence, frequency: frequency, k: k, frame: frame);
     }
 
-    int sum = sequence.len() - k + 1;
-    foreach (str c, int f in frequency) {
+    final sum = sequence.len() - k + 1;
+    foreach (c, f in frequency) {
         std\print("{c} {(f * 100) / sum}");
     }
     std\print("");
 }
 
 // buzz tests/bench/005-k-nucleoide.buzz < tests/bench/reference/knucleotide-input.txt
-fun main([str] _) > void {
-    str sequence = readSequence() catch "";
+fun main(_: [str]) > void {
+    final sequence = readSequence() catch "";
     frequency(sequence, k: 1);
     frequency(sequence, k: 2);
     count(sequence, fragment: "GGT");
@@ -62,4 +62,4 @@ fun main([str] _) > void {
     count(sequence, fragment: "GGTATT");
     count(sequence, fragment: "GGTATTTTAATT");
     count(sequence, fragment: "GGTATTTTAATTTATAGT");
-}
\ No newline at end of file
+}
diff --git a/tests/bench/006-fasta.buzz b/tests/bench/006-fasta.buzz
index fd984011..3eda7388 100644
--- a/tests/bench/006-fasta.buzz
+++ b/tests/bench/006-fasta.buzz
@@ -2,37 +2,37 @@ import "std";
 import "math";
 import "buffer" as _;
 
-final double IM = 139968.0;
-final double IA = 3877.0;
-final double IC = 29573.0;
-final int lineLength = 60;
-final int bufferSize = (lineLength + 1) * 1024;
+final IM = 139968.0;
+final IA = 3877.0;
+final IC = 29573.0;
+final lineLength = 60;
+final bufferSize = (lineLength + 1) * 1024;
 
-fun makeRepeatFasta(str id, str desc, str s, int nchars) > void {
+fun makeRepeatFasta(id: str, desc: str, s: str, nchars: int) > void {
     std\print(">{id} {desc}");
-    int p = 0;
-    int sn = s.len();
-    str s2 = s + s;
-    for (int i = lineLength; i < nchars; i = i + lineLength) {
+    var p = 0;
+    final sn = s.len();
+    final s2 = s + s;
+    for (i: int = lineLength; i < nchars; i = i + lineLength) {
         std\print(s2.sub(p, len: lineLength - 1));
         p = p + lineLength;
         if (p > sn) {
             p = p - sn;
         }
     }
-    int tail = nchars % lineLength;
+    final tail = nchars % lineLength;
     if (tail > 0) {
         std\print(s2.sub(p, len: tail - 1));
     }
 }
 
 object Frequency {
-    Buffer chars,
-    [double] probs,
-    double last,
+    chars: Buffer,
+    probs: [double],
+    last: double,
 
-    static fun init(Buffer chars, [double] probs, double last) > Frequency {
-        Frequency freq = Frequency{
+    static fun init(chars: Buffer, probs: [double], last: double) > Frequency {
+        final freq = Frequency{
             chars = chars,
             probs = probs,
             last = last,
@@ -43,29 +43,29 @@ object Frequency {
         return freq;
     }
 
-    fun random(double max) > double {
+    fun random(max: double) > double {
         this.last = (this.last * IA + IC) % IM;
         return max * this.last * (1.0 / IM);
     }
 
     fun makeCumulative() > void {
-        double cp = 0.0;
-        foreach (int i, double prob in this.probs) {
+        var cp = 0.0;
+        foreach (i, prob in this.probs) {
             cp = cp + prob;
             this.probs[i] = cp;
         }
     }
 
-    fun selectRandomIntoBuffer(Buffer buffer, int initialBufferIndex, int nRandom) > int !> OutOfBoundError, WriteWhileReadingError {
-        final int len = this.probs.len();
+    fun selectRandomIntoBuffer(buffer: Buffer, initialBufferIndex: int, nRandom: int) > int !> OutOfBoundError, WriteWhileReadingError {
+        final len = this.probs.len();
         var bufferIndex = initialBufferIndex;
 
-        for (int rIndex = 0; rIndex < nRandom; rIndex = rIndex + 1) {
-            double r = this.random(1.0);
-            bool skip = false;
-            for (int i = 0; i < len; i = i + 1) {
+        foreach (_ in 0..nRandom) {
+            final r = this.random(1.0);
+            var skip = false;
+            foreach (_ in 0..len) {
                 if (r < this.probs[i]) {
-                    buffer\setAt(bufferIndex, value: this.chars.at(i));
+                    buffer.setAt(bufferIndex, value: this.chars.at(i));
                     bufferIndex = bufferIndex + 1;
                     skip = true;
                     break;
@@ -73,7 +73,7 @@ object Frequency {
             }
 
             if (!skip) {
-                buffer\setAt(bufferIndex, value: this.chars.at(len - 1));
+                buffer.setAt(bufferIndex, value: this.chars.at(len - 1));
                 bufferIndex = bufferIndex + 1;
             }
         }
@@ -82,32 +82,32 @@ object Frequency {
     }
 }
 
-fun makeRandomFasta(str id, str desc, Frequency fpf, int initialNchars) > void !> OutOfBoundError, WriteWhileReadingError {
+fun makeRandomFasta(id: str, desc: str, fpf: Frequency, initialNchars: int) > void !> OutOfBoundError, WriteWhileReadingError {
     std\print(">{id} {desc}");
     var nchars = initialNchars;
 
-    Buffer buffer = Buffer.init(bufferSize);
-    int bufferIndex = 0;
+    var buffer = Buffer.init(bufferSize);
+    var bufferIndex = 0;
     while (nchars > 0) {
-        int chunkSize = std\toInt(math\minDouble(a: std\toDouble(lineLength), b: std\toDouble(nchars)));
+        final chunkSize = std\toInt(math\minDouble(a: std\toDouble(lineLength), b: std\toDouble(nchars)));
 
         if (bufferIndex == bufferSize) {
-            std\print(buffer\toString().sub(0, len: bufferIndex));
+            std\print(buffer.toString().sub(0, len: bufferIndex));
             buffer = Buffer.init(bufferSize);
             bufferIndex = 0;
         }
 
         bufferIndex = fpf.selectRandomIntoBuffer(buffer, initialBufferIndex: bufferIndex, nRandom: chunkSize);
-        buffer\setAt(bufferIndex, value: 10);
+        buffer.setAt(bufferIndex, value: 10);
         bufferIndex = bufferIndex + 1;
 
         nchars = nchars - chunkSize;
     }
 
-    std\print(buffer\toString().sub(0, len: bufferIndex));
+    std\print(buffer.toString().sub(0, len: bufferIndex));
 }
 
-final str alu = "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"
+final alu = "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"
     + "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"
     + "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"
     + "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"
@@ -115,17 +115,14 @@ final str alu = "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"
     + "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"
     + "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
 
-fun main([str] args) > void !> any {
-    int N = 1000;
-    if (args.len() > 0) {
-        N = std\parseInt(args[0]) ?? 1000;
-    }
+fun main(args: [str]) > void !> any {
+    final N = std\parseInt(args[?0] ?? "1000") ?? 1000;
 
     makeRepeatFasta("ONE", desc: "Homo sapiens alu", s: alu, nchars: N * 2);
 
-    Buffer iubChars = Buffer.init();
+    final iubChars = Buffer.init();
     iubChars.write("acgtBDHKMNRSVWY");
-    final Frequency iub = Frequency.init(
+    final iub = Frequency.init(
         chars: iubChars,
         probs: [ 0.27, 0.12, 0.12, 0.27, 0.02, 0.02, 0.02, 0.02, 0.02, 0.02, 0.02, 0.02, 0.02, 0.02, 0.02 ],
         last: 42.0,
@@ -133,13 +130,13 @@ fun main([str] args) > void !> any {
 
     makeRandomFasta("TWO", desc: "IUB ambiguity codes", fpf: iub, initialNchars: N * 3);
 
-    Buffer homoSapiensChars = Buffer.init();
+    final homoSapiensChars = Buffer.init();
     homoSapiensChars.write("acgt");
-    final Frequency homoSapiens = Frequency.init(
+    final homoSapiens = Frequency.init(
         chars: homoSapiensChars,
         probs: [ 0.3029549426680, 0.1979883004921, 0.1975473066391, 0.3015094502008 ],
         last: iub.last,
     );
 
     makeRandomFasta("THREE", desc: "Homo sapiens frequency", fpf: homoSapiens, initialNchars: N * 5);
-}
\ No newline at end of file
+}
diff --git a/tests/bench/007-fib.buzz b/tests/bench/007-fib.buzz
index 90f8ff95..54bbfd8c 100644
--- a/tests/bench/007-fib.buzz
+++ b/tests/bench/007-fib.buzz
@@ -1,6 +1,6 @@
 import "std";
 
-fun fibonnacci(int n) > int {
+fun fibonnacci(n: int) > int {
     if (n < 2) {
         return n;
     }
@@ -8,6 +8,6 @@ fun fibonnacci(int n) > int {
     return fibonnacci(n - 2) + fibonnacci(n - 1);
 }
 
-fun main([str] _) > void {
+fun main(_: [str]) > void {
     std\print("{fibonnacci(30)}");
-}
\ No newline at end of file
+}
diff --git a/tests/bench/008-for.buzz b/tests/bench/008-for.buzz
index a373ecac..fc24a869 100644
--- a/tests/bench/008-for.buzz
+++ b/tests/bench/008-for.buzz
@@ -1,16 +1,16 @@
 import "std";
 
-fun main([str] _) > void {
-    [int] list = [<int>];
+fun main(_: [str]) > void {
+    final list = [<int>];
 
-    for (int i = 0; i < 1000000; i = i + 1) {
+    foreach (i in 0..1_000_000) {
         list.append(i);
     }
 
-    int sum = 0;
-    foreach (int v in list) {
+    var sum = 0;
+    foreach (v in list) {
         sum = sum + v;
     }
 
     std\print("{sum}");
-}
\ No newline at end of file
+}
diff --git a/tests/bench/009-grid.buzz b/tests/bench/009-grid.buzz
index e868c032..14a7c13d 100644
--- a/tests/bench/009-grid.buzz
+++ b/tests/bench/009-grid.buzz
@@ -1,18 +1,18 @@
 import "std";
 
-fun main([str] args) > void {
-    final int width = (if (args.len() > 0) std\parseInt(args[0]) else 80) ?? 80;
-    final int height = (if (args.len() > 1) std\parseInt(args[1]) else 60) ?? 60;
+fun main(args: [str]) > void {
+    final width = std\parseInt(args[?0] ?? "80") ?? 80;
+    final height = std\parseInt(args[?1] ?? "60") ?? 60;
 
     var cells = [<bool>];
 
-    for (int i = 0; i < width * height; i = i + 1) {
+    foreach (_ in 0..width * height) {
         cells.append(std\random(max: 5) == 1);
     }
 
-    for (int y = 0; y < height; y = y + 1) {
-        for (int x = 0; x < width; x = x + 1) {
+    foreach (y in 0..height) {
+        foreach (x in 0..width) {
             cells[y * width + x] = !cells[y * width + x];
         }
     }
-}
\ No newline at end of file
+}
diff --git a/tests/bench/010-ackermann.buzz b/tests/bench/010-ackermann.buzz
index 812ba43c..808b761c 100644
--- a/tests/bench/010-ackermann.buzz
+++ b/tests/bench/010-ackermann.buzz
@@ -1,13 +1,13 @@
 import "std";
 
-fun main([str] args) > void {
-    final m = (if (args.len() > 0) std\parseInt(args[0]) else null) ?? 3;
-    final n = (if (args.len() > 1) std\parseInt(args[1]) else null) ?? 8;
+fun main(args: [str]) > void {
+    final m = std\parseInt(args[?0] ?? "3") ?? 3;
+    final n = std\parseInt(args[?1] ?? "8") ?? 8;
 
     std\print("result: {ack(m, n)}");
 }
 
-fun ack(int m, int n) > int {
+fun ack(m: int, n: int) > int {
     if (m == 0) {
         return n + 1;
     }
@@ -20,4 +20,4 @@ fun ack(int m, int n) > int {
         m: m - 1,
         n: ack(m, n: n - 1)
     );
-}
\ No newline at end of file
+}
diff --git a/tests/bench/011-bubble-sort.buzz b/tests/bench/011-bubble-sort.buzz
index a5e8c669..94812940 100644
--- a/tests/bench/011-bubble-sort.buzz
+++ b/tests/bench/011-bubble-sort.buzz
@@ -1,33 +1,33 @@
 import  "std";
 
-fun main([str] args) > void {
-    final max = (if (args.len() > 0) std\parseInt(args[0]) else null) ?? 750;
+fun main(args: [str]) > void {
+    final max = std\parseInt(args[?0] ?? "750") ?? 750;
 
     var list = init(max);
 
     bubblesort(list);
 
-    foreach (int e in list) {
+    foreach (e in list) {
         std\print("{e}");
     }
 }
 
-fun init(int max) > [int] {
-    [int] list = [];
+fun init(max: int) > [int] {
+    final list = [<int>];
     final f = max - 13;
     final h = ((max - 117) * (max - 13)) / max;
 
-    for (int i = 0; i < max; i = i + 1) {
+    foreach (i in 0..max) {
         list.append((f * i) % h - (h / 2));
     }
 
     return list;
 }
 
-fun bubblesort([int] list) > void {
+fun bubblesort(list: [int]) > void {
     final len = list.len();
-    for (int i = 0; i < len - 1; i = i + 1) {
-        for (int j = 0; j < len - 1; j = j + 1) {
+    foreach (_ in 0..(len - 1)) {
+        foreach (j in 0..(len - 1)) {
             if (list[j] > list[j + 1]) {
                 final tmp = list[j];
                 list[j] = list[j + 1];
@@ -35,4 +35,4 @@ fun bubblesort([int] list) > void {
             }
         }
     }
-}
\ No newline at end of file
+}