diff --git a/README.rst b/README.rst
index 9cada6a..3038fc9 100644
--- a/README.rst
+++ b/README.rst
@@ -8,7 +8,8 @@ dN/dS Calculator
     :target: https://pypi.python.org/pypi/dnds
 
 Calculate dN/dS ratio precisely (Ka/Ks) using a codon-by-codon counting
-method.
+method. Also calculates the pN/pS ratio precisely (previously referred to as
+dN/dS).
 
 Usage
 -----
@@ -17,7 +18,9 @@ Usage
 
     >>> sequence_1 = "ATGCTTTTGAAATCG"
     >>> sequence_2 = "ATGCGTTCGAAGTCG"
-    >>> dnds(sequence_1, sequence2)
+    >>> pnps(sequence_1, sequence2)
     Fraction(38, 71)
-    >>> round(float(dnds(sequence_1, sequence2)), 3)
+    >>> round(float(pnps(sequence_1, sequence2)), 3)
     0.535
+    >>> round(dnds(sequence_1, sequence_2), 3)
+    0.467
diff --git a/dnds.py b/dnds.py
index e982fbc..e7477b1 100644
--- a/dnds.py
+++ b/dnds.py
@@ -1,6 +1,13 @@
+"""dnds
+
+This module is a reference implementation of estimating nucleotide substitution
+neutrality by estimating the percent of synonymous and nonsynonymous mutations.
+"""
 from __future__ import print_function, division
-from codons import codons
+from math import log
 from fractions import Fraction
+import logging
+from codons import codons
 
 BASES = {'A', 'G', 'T', 'C'}
 
@@ -80,16 +87,16 @@ def codon_subs(codon1, codon2):
         return 0
     elif diff == 1:
         return int(translate(codon1) == translate(codon2))
-    else:
-        syn = 0
-        for i in range(len(codon1)):
-            base1 = codon1[i]
-            base2 = codon2[i]
-            if base1 != base2:
-                new_codon = codon1[:i] + base2 + codon1[i + 1:]
-                syn += int(is_synonymous(codon1, new_codon))
-                syn += int(is_synonymous(codon2, new_codon))
-        return syn / diff
+
+    syn = 0
+    for i in range(len(codon1)):
+        base1 = codon1[i]
+        base2 = codon2[i]
+        if base1 != base2:
+            new_codon = codon1[:i] + base2 + codon1[i + 1:]
+            syn += int(is_synonymous(codon1, new_codon))
+            syn += int(is_synonymous(codon2, new_codon))
+    return syn / diff
 
 
 def substitutions(seq1, seq2):
@@ -105,27 +112,57 @@ def substitutions(seq1, seq2):
     return (syn, dna_changes - syn)
 
 
+def clean_sequence(seq):
+    """Clean up provided sequence by removing whitespace."""
+    return seq.replace(' ', '')
+
+
+def pnps(seq1, seq2):
+    """Main function to calculate pN/pS between two DNA sequences."""
+    # Strip any whitespace from both strings
+    seq1 = clean_sequence(seq1)
+    seq2 = clean_sequence(seq2)
+    # Check that both sequences have the same length
+    assert len(seq1) == len(seq2)
+    # Check that sequences are codons
+    assert len(seq1) % 3 == 0
+
+    syn_sites = syn_sum(seq1, seq2)
+    non_sites = len(seq1) - syn_sites
+    logging.info('Sites (syn/nonsyn): {}, {}'.format(syn_sites, non_sites))
+    syn_subs, non_subs = substitutions(seq1, seq2)
+    logging.info('pN: {} / {}\t\tpS: {} / {}'
+                 .format(non_subs, round(non_sites), syn_subs, round(syn_sites)))
+    pn = non_subs / non_sites
+    ps = syn_subs / syn_sites
+    return pn / ps
+
+
 def dnds(seq1, seq2):
-    """Main function to calculate dN/dS between two DNA sequences"""
+    """Main function to calculate dN/dS between two DNA sequences per Nei &
+    Gojobori 1986. This includes the per site conversion adapted from Jukes &
+    Cantor 1967.
+    """
     # Strip any whitespace from both strings
-    seq1 = seq1.replace(' ', '')
-    seq2 = seq2.replace(' ', '')
+    seq1 = clean_sequence(seq1)
+    seq2 = clean_sequence(seq2)
     # Check that both sequences have the same length
     assert len(seq1) == len(seq2)
     # Check that sequences are codons
     assert len(seq1) % 3 == 0
-    assert len(seq2) % 3 == 0
+
     syn_sites = syn_sum(seq1, seq2)
     non_sites = len(seq1) - syn_sites
-    # print(syn_sites, non_sites)
+    logging.info('Sites (syn/nonsyn): {}, {}'.format(syn_sites, non_sites))
     syn_subs, non_subs = substitutions(seq1, seq2)
-    # print('dN: {} / {}\t\tdS: {} / {}'
-    #       .format(non_subs, round(non_sites), syn_subs, round(syn_sites)))
-    dn = non_subs / non_sites
-    ds = syn_subs / syn_sites
+    pn = non_subs / non_sites
+    ps = syn_subs / syn_sites
+    dn = -(3 / 4) * log(1 - (4 * pn / 3))
+    ds = -(3 / 4) * log(1 - (4 * ps / 3))
+    logging.info('dN: {}\t\tdS: {}'.format(round(dn, 3), round(ds, 3)))
     return dn / ds
 
 
 if __name__ == '__main__':
-    print(dnds('ACC GTG GGA TGC ACC GGT GTG CCC',
+    print(pnps('ACC GTG GGA TGC ACC GGT GTG CCC',
                'ACA GTG AGA TAT AAA GGA GAG AAC'))
diff --git a/setup.py b/setup.py
index 3432a1a..739455b 100644
--- a/setup.py
+++ b/setup.py
@@ -8,7 +8,7 @@
     version=version,
     description="Calculate dN/dS ratio precisely (Ka/Ks) using a codon-by-codon counting method.",
     author="Adel Qalieh",
-    author_email="adelq@sas.upenn.edu",
+    author_email="adelq@med.umich.edu",
     url="https://github.com/adelq/dnds",
     license="MIT",
     py_modules=['dnds', 'codons'],
@@ -22,4 +22,5 @@
         'Programming Language :: Python :: 3',
         'Programming Language :: Python :: 3.4',
         'Programming Language :: Python :: 3.5',
+        'Programming Language :: Python :: 3.6',
     ])
diff --git a/test_dnds.py b/test_dnds.py
index ede66b2..8d7506c 100644
--- a/test_dnds.py
+++ b/test_dnds.py
@@ -1,6 +1,7 @@
-from dnds import dnds, substitutions, dnds_codon, dnds_codon_pair, syn_sum, translate
+from __future__ import division
 from fractions import Fraction
 from nose.tools import assert_equal, assert_almost_equal
+from dnds import dnds, pnps, substitutions, dnds_codon, dnds_codon_pair, syn_sum, translate
 
 # From Canvas practice problem
 TEST_SEQ1 = 'ACTCCGAACGGGGCGTTAGAGTTGAAACCCGTTAGA'
@@ -8,6 +9,9 @@
 # From in-class problem set
 TEST_SEQ3 = 'ATGCTTTTGAAATCGATCGTTCGTTCACATCGATGGATC'
 TEST_SEQ4 = 'ATGCGTTCGAAGTCGATCGATCGCTCAGATCGATCGATC'
+# From http://bioinformatics.cvr.ac.uk/blog/calculating-dnds-for-ngs-datasets/
+TEST_SEQ5 = 'ATGAAACCCGGGTTTTAA'
+TEST_SEQ6 = 'ATGAAACGCGGCTACTAA'
 
 
 def test_translate():
@@ -77,9 +81,14 @@ def test_syn_subs():
     assert_equal(substitutions("CCC", "AAC"), (0, 2))
 
 
+def test_pnps():
+    assert_almost_equal(pnps(TEST_SEQ1, TEST_SEQ2), 0.269, delta=0.1)
+    assert_almost_equal(pnps(TEST_SEQ3, TEST_SEQ4), 0.86, delta=0.1)
+    assert_almost_equal(pnps(TEST_SEQ5, TEST_SEQ6), 0.1364 / 0.6001, delta=1e-4)
+
+
 def test_dnds():
-    assert_almost_equal(dnds(TEST_SEQ1, TEST_SEQ2), 0.269, delta=0.1)
-    assert_almost_equal(dnds(TEST_SEQ3, TEST_SEQ4), 0.86, delta=0.1)
+    assert_almost_equal(dnds(TEST_SEQ5, TEST_SEQ6), 0.1247, delta=1e-4)
 
 # DNDS.pdf - wrong based on email conversation with Sean
 #