Skip to content

Commit

Permalink
Added scrappie link
Browse files Browse the repository at this point in the history
  • Loading branch information
Psy-Fer committed Mar 25, 2019
1 parent 2a87258 commit 4f0496d
Showing 1 changed file with 1 addition and 1 deletion.
2 changes: 1 addition & 1 deletion README.md
Original file line number Diff line number Diff line change
Expand Up @@ -179,7 +179,7 @@ fasta format for scrappie:
>my_kmer_name
ATCGATCGCTATGCTAGCATTACG

Make the model from scrappie:
Make the model from scrappie (available from ONT [here](https://github.com/nanoporetech/scrappie) ):

scrappie squiggle my_kmer.fa > scrappie_kmer.model

Expand Down

0 comments on commit 4f0496d

Please sign in to comment.