From ee49a01c536b8b4915a88c469f2f1ccc78bdf70a Mon Sep 17 00:00:00 2001 From: Valentin Antonescu Date: Thu, 11 Feb 2016 12:20:57 -0500 Subject: [PATCH] release 2.2.7 commits. --- MANUAL | 28 ++++++++++++++-------------- doc/website/manual.ssi | 1 - doc/website/old_news.ssi | 23 +++++++++++++++++++++++ doc/website/recent_news.ssi | 30 ++++++++---------------------- doc/website/rhsidebar.ssi | 4 ++-- 5 files changed, 47 insertions(+), 39 deletions(-) diff --git a/MANUAL b/MANUAL index ffcc98d6b..947e8ce66 100644 --- a/MANUAL +++ b/MANUAL @@ -304,11 +304,11 @@ reference. For an alignment to be considered "valid" (i.e. "good enough") by Bowtie 2, it must have an alignment score no less than the minimum score threshold. The threshold is configurable and is expressed as a function of the read length. In -end-to-end alignment mode, the default minimum score threhsold is `-0.6 + -0.6 * -L`, where `L` is the read length. In local alignment mdoe, the default minimum +end-to-end alignment mode, the default minimum score threshold is `-0.6 + -0.6 * +L`, where `L` is the read length. In local alignment mode, the default minimum score threshold is `20 + 8.0 * ln(L)`, where L is the read length. This can be configured with the `--score-min` option. For details on how to set options -like `--score-min` that correpond to functions, see the section on [setting +like `--score-min` that correspond to functions, see the section on [setting function options]. Mapping quality: higher = more unique @@ -419,16 +419,16 @@ alignment status of pairs per se, not individual mates. The SAM `FLAGS` field, the second field in a SAM record, has multiple bits that describe the paired-end nature of the read and alignment. The first (least -significant) bit (1 in decimal, 0x1 in hexidecimal) is set if the read is part -of a pair. The second bit (2 in decimal, 0x2 in hexidecimal) is set if the read +significant) bit (1 in decimal, 0x1 in hexadecimal) is set if the read is part +of a pair. The second bit (2 in decimal, 0x2 in hexadecimal) is set if the read is part of a pair that aligned in a paired-end fashion. The fourth bit (8 in -decimal, 0x8 in hexidecimal) is set if the read is part of a pair and the other +decimal, 0x8 in hexadecimal) is set if the read is part of a pair and the other mate in the pair had at least one valid alignment. The sixth bit (32 in -decimal, 0x20 in hexidecimal) is set if the read is part of a pair and the other +decimal, 0x20 in hexadecimal) is set if the read is part of a pair and the other mate in the pair aligned to the Crick strand (or, equivalently, if the reverse complement of the other mate aligned to the Watson strand). The seventh bit (64 -in decimal, 0x40 in hexidecimal) is set if the read is mate 1 in a pair. The -eighth bit (128 in decimal, 0x80 in hexidecimal) is set if the read is mate 2 in +in decimal, 0x40 in hexadecimal) is set if the read is mate 1 in a pair. The +eighth bit (128 in decimal, 0x80 in hexadecimal) is set if the read is mate 2 in a pair. See the [SAM specification] for a more detailed description of the `FLAGS` field. @@ -523,7 +523,7 @@ because it exceeded a limit placed on search effort (see `-D` and `-R`) or because it already knows all it needs to know to report an alignment. Information from the best alignments are used to estimate mapping quality (the `MAPQ` [SAM] field) and to set SAM optional fields, such as `AS:i` and -`XS:i`. Bowtie 2 does not garantee that the alignment reported is the best +`XS:i`. Bowtie 2 does not guarantee that the alignment reported is the best possible in terms of alignment score. See also: `-D`, which puts an upper limit on the number of dynamic programming @@ -678,7 +678,7 @@ ambiguous nucleotides. Bowtie 2 will still print a SAM record for such a read, but no alignment will be reported and and the `YF:i` SAM optional field will be set to indicate the reason the read was filtered. -* `YF:Z:LN`: the read was filtered becuase it had length less than or equal to +* `YF:Z:LN`: the read was filtered because it had length less than or equal to the number of seed mismatches set with the `-N` option. * `YF:Z:NS`: the read was filtered because it contains a number of ambiguous characters (usually `N` or `.`) greater than the ceiling specified with @@ -978,14 +978,14 @@ alignment]. Can be set to 0 or 1. Setting this higher makes alignment slower -L Sets the length of the seed substrings to align during [multiseed alignment]. -Smaller values make alignment slower but more senstive. Default: the +Smaller values make alignment slower but more sensitive. Default: the `--sensitive` preset is used by default, which sets `-L` to 20 both in `--end-to-end` mode and in `--local` mode. -i Sets a function governing the interval between seed substrings to use during -[multiseed alignment]. For instance, if the read has 30 characers, and seed +[multiseed alignment]. For instance, if the read has 30 characters, and seed length is 10, and the seed interval is 6, the seeds extracted will be: Read: TAGCTACGCTCTACGCTATCATGCATAAAC @@ -1462,7 +1462,7 @@ When one or more `--rg` arguments are specified, `bowtie2` will also print an `@RG` line that includes all user-specified `--rg` tokens separated by tabs. -Each subsequnt line describes an alignment or, if the read failed to align, a +Each subsequent line describes an alignment or, if the read failed to align, a read. Each line is a collection of at least 12 fields separated by tabs; from left to right, the fields are: diff --git a/doc/website/manual.ssi b/doc/website/manual.ssi index 25536a24a..bf0622257 100644 --- a/doc/website/manual.ssi +++ b/doc/website/manual.ssi @@ -1330,4 +1330,3 @@ r7 16 gi|9626243|ref|NC_001416.1| 4692 42 143M * 0 0 TCAGCCGGACGC

Then to view the variants, run:

bcftools view eg2.raw.bcf

See the official SAMtools guide to Calling SNPs/INDELs with SAMtools/BCFtools for more details and variations on this process.

- diff --git a/doc/website/old_news.ssi b/doc/website/old_news.ssi index 06f0461d7..dc0983bf0 100644 --- a/doc/website/old_news.ssi +++ b/doc/website/old_news.ssi @@ -3,6 +3,29 @@
  • Bowtie 2 source now lives in a public GitHub repository.
    • +

    Version 2.2.0 - February 17, 2014

    +
      +
    • Improved index querying efficiency using "population count" + instructions available since + SSE4.2
      • +
    • Added support for large and small indexes, removing 4-billion-nucleotide + barrier. Bowtie 2 can now be used with reference genomes of any size.
      • +
    • Fixed bug that could cause bowtie2-build to crash when reference length + is close to 4 billion.
      • +
    • Added a CL: string to the @PG SAM header to preserve information about + the aligner binary and paramteres.
      • +
    • Fixed bug that could cause bowtie2-build to crash when reference length + is close to 4 billion.
      • +
    • No longer releasing 32-bit binaries. Simplified manual and Makefile + accordingly.
      • +
    • Credits to the Intel® enabling team for performance optimizations + included in this release. Thank you!
      • +
    • Phased out CygWin support. MinGW can still be used for Windows building.
      • +
    • Added the .bat generation for Windows.
      • +
    • Fixed some issues with some uncommon chars in fasta files.
      • +
    • Fixed wrappers so bowtie can now be used with symlinks.
      • +
    +

    Version 2.1.0 - February 21, 2013

    • Improved multithreading support so that Bowtie 2 now uses native Windows diff --git a/doc/website/recent_news.ssi b/doc/website/recent_news.ssi index 0db59a97a..119b04709 100644 --- a/doc/website/recent_news.ssi +++ b/doc/website/recent_news.ssi @@ -1,6 +1,14 @@

      Bowtie2 developers note

      As of Nov 2015 we had to fix the bowtie2 github repo and relabel the entire history. Developers and contributors should re-clone the bowtie2 github repo from this current state.

      +

      Version 2.2.7 - Feb 10, 2016

      +
        +
      • Added a parallel index build option: bowtie2-build --threads <# threads>.
        • +
      • Fixed an issue whereby IUPAC codes (other than A/C/G/T/N) in reads were converted to As. Now all non-A/C/G/T characters in reads become Ns.
        • +
      • Fixed some compilation issues, including for the Intel C++ Compiler.
        • +
      • Removed debugging code that could impede performance for many alignment threads.
        • +
      • Fixed a few typos in documentation.
        • +

      Version 2.2.6 - Jul 22, 2015

      • Switched to a stable sort to avoid some potential reproducibility confusions.
        • @@ -71,27 +79,5 @@ governing the multiseed heuristic.
      -

      Version 2.2.0 - February 17, 2014

      -
        -
      • Improved index querying efficiency using "population count" - instructions available since - SSE4.2
        • -
      • Added support for large and small indexes, removing 4-billion-nucleotide - barrier. Bowtie 2 can now be used with reference genomes of any size.
        • -
      • Fixed bug that could cause bowtie2-build to crash when reference length - is close to 4 billion.
        • -
      • Added a CL: string to the @PG SAM header to preserve information about - the aligner binary and paramteres.
        • -
      • Fixed bug that could cause bowtie2-build to crash when reference length - is close to 4 billion.
        • -
      • No longer releasing 32-bit binaries. Simplified manual and Makefile - accordingly.
        • -
      • Credits to the Intel® enabling team for performance optimizations - included in this release. Thank you!
        • -
      • Phased out CygWin support. MinGW can still be used for Windows building.
        • -
      • Added the .bat generation for Windows.
        • -
      • Fixed some issues with some uncommon chars in fasta files.
        • -
      • Fixed wrappers so bowtie can now be used with symlinks.
        • -
      diff --git a/doc/website/rhsidebar.ssi b/doc/website/rhsidebar.ssi index 5c4922163..5064d21f8 100644 --- a/doc/website/rhsidebar.ssi +++ b/doc/website/rhsidebar.ssi @@ -15,10 +15,10 @@
      - Bowtie2 2.2.6 + Bowtie2 2.2.7 - 7/22/15  + 2/10/16